Incidental Mutation 'R5928:Plekha7'
ID460009
Institutional Source Beutler Lab
Gene Symbol Plekha7
Ensembl Gene ENSMUSG00000045659
Gene Namepleckstrin homology domain containing, family A member 7
SynonymsA430081P20Rik
MMRRC Submission 044123-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R5928 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location116123485-116308376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116128574 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 85 (K85R)
Ref Sequence ENSEMBL: ENSMUSP00000150646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084664] [ENSMUST00000181998] [ENSMUST00000182834] [ENSMUST00000214700] [ENSMUST00000217046]
Predicted Effect probably benign
Transcript: ENSMUST00000084664
AA Change: K1017R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081714
Gene: ENSMUSG00000045659
AA Change: K1017R

DomainStartEndE-ValueType
Blast:PH 1 47 2e-23 BLAST
SCOP:d1kz7a2 18 69 1e-5 SMART
low complexity region 100 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 322 351 N/A INTRINSIC
coiled coil region 461 500 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
low complexity region 677 693 N/A INTRINSIC
coiled coil region 828 856 N/A INTRINSIC
low complexity region 947 959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181998
AA Change: K1253R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138575
Gene: ENSMUSG00000045659
AA Change: K1253R

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
low complexity region 1183 1195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182443
AA Change: K1171R
Predicted Effect probably benign
Transcript: ENSMUST00000182834
AA Change: K1207R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138257
Gene: ENSMUSG00000045659
AA Change: K1207R

DomainStartEndE-ValueType
PH 118 237 1.42e-18 SMART
low complexity region 290 302 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 512 541 N/A INTRINSIC
coiled coil region 651 690 N/A INTRINSIC
coiled coil region 719 752 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
coiled coil region 1018 1046 N/A INTRINSIC
low complexity region 1137 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214700
AA Change: K85R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217046
AA Change: K85R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Plekha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Plekha7 APN 7 116135184 missense probably damaging 1.00
IGL01133:Plekha7 APN 7 116145241 splice site probably null
IGL01146:Plekha7 APN 7 116157473 splice site probably benign
IGL01307:Plekha7 APN 7 116145244 splice site probably benign
IGL02063:Plekha7 APN 7 116140701 missense possibly damaging 0.78
IGL02110:Plekha7 APN 7 116154628 splice site probably null
IGL02420:Plekha7 APN 7 116158234 missense probably damaging 1.00
IGL02660:Plekha7 APN 7 116157574 splice site probably benign
IGL02851:Plekha7 APN 7 116135178 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0130:Plekha7 UTSW 7 116170704 missense probably damaging 0.99
R0348:Plekha7 UTSW 7 116158020 missense probably damaging 1.00
R0595:Plekha7 UTSW 7 116144968 missense probably damaging 1.00
R0614:Plekha7 UTSW 7 116154645 nonsense probably null
R0732:Plekha7 UTSW 7 116145237 missense probably damaging 1.00
R1664:Plekha7 UTSW 7 116135034 splice site probably null
R1695:Plekha7 UTSW 7 116128685 missense probably damaging 1.00
R1794:Plekha7 UTSW 7 116140681 missense probably damaging 1.00
R1895:Plekha7 UTSW 7 116144974 missense probably damaging 1.00
R2153:Plekha7 UTSW 7 116175767 missense probably damaging 1.00
R3106:Plekha7 UTSW 7 116164404 missense probably benign 0.02
R3605:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3606:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3789:Plekha7 UTSW 7 116175734 missense probably damaging 1.00
R4584:Plekha7 UTSW 7 116237533 intron probably benign
R4750:Plekha7 UTSW 7 116137311 missense probably damaging 1.00
R4774:Plekha7 UTSW 7 116144943 missense probably damaging 1.00
R4810:Plekha7 UTSW 7 116144938 missense probably damaging 1.00
R4895:Plekha7 UTSW 7 116189391 unclassified probably null
R4925:Plekha7 UTSW 7 116158128 missense probably damaging 1.00
R5556:Plekha7 UTSW 7 116164149 missense probably benign 0.20
R5599:Plekha7 UTSW 7 116176882 splice site probably null
R5848:Plekha7 UTSW 7 116140399 missense probably damaging 1.00
R5941:Plekha7 UTSW 7 116124805 missense possibly damaging 0.56
R6351:Plekha7 UTSW 7 116176898 missense probably damaging 1.00
R6520:Plekha7 UTSW 7 116164482 missense probably benign 0.16
R6699:Plekha7 UTSW 7 116135175 missense probably damaging 1.00
R6781:Plekha7 UTSW 7 116157855 critical splice donor site probably null
R6843:Plekha7 UTSW 7 116143320 missense probably benign 0.45
R6977:Plekha7 UTSW 7 116135967 missense probably benign 0.01
R7048:Plekha7 UTSW 7 116148324 missense probably benign 0.07
R7269:Plekha7 UTSW 7 116181212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAATGTCCCTGTCACCTTGTC -3'
(R):5'- TTGAAGAGTCACCTCCCTGC -3'

Sequencing Primer
(F):5'- CCTTGTCTCAGAGCTGGCAGATATG -3'
(R):5'- CTGCAGCCAGGGAGATACATG -3'
Posted On2017-02-28