Incidental Mutation 'R5928:Cdc25a'
ID460020
Institutional Source Beutler Lab
Gene Symbol Cdc25a
Ensembl Gene ENSMUSG00000032477
Gene Namecell division cycle 25A
SynonymsD9Ertd393e
MMRRC Submission 044123-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5928 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109875579-109893895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109889793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 354 (V354A)
Ref Sequence ENSEMBL: ENSMUSP00000142958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094324] [ENSMUST00000198308]
Predicted Effect probably damaging
Transcript: ENSMUST00000094324
AA Change: V415A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091882
Gene: ENSMUSG00000032477
AA Change: V415A

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 85 318 3.6e-69 PFAM
RHOD 356 469 2.6e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198219
Predicted Effect probably damaging
Transcript: ENSMUST00000198308
AA Change: V354A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142958
Gene: ENSMUSG00000032477
AA Change: V354A

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 24 258 1.2e-88 PFAM
RHOD 295 408 5.97e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199353
Predicted Effect probably damaging
Transcript: ENSMUST00000199787
AA Change: V199A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25A is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit elevated levels of early erythroid progenitor cell cycling but erythropoiesis is normally unaffected. Homozygous deletion of this gene is lethal and male heterozygotes display decreased vertebral trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Cdc25a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cdc25a APN 9 109876126 unclassified probably null
IGL01761:Cdc25a APN 9 109891865 intron probably benign
IGL02808:Cdc25a APN 9 109883599 unclassified probably null
IGL03241:Cdc25a APN 9 109884199 splice site probably null
P4748:Cdc25a UTSW 9 109884108 splice site probably benign
R1472:Cdc25a UTSW 9 109876089 missense probably benign 0.00
R1571:Cdc25a UTSW 9 109881546 missense possibly damaging 0.56
R1598:Cdc25a UTSW 9 109879893 frame shift probably null
R4135:Cdc25a UTSW 9 109881517 missense possibly damaging 0.62
R4301:Cdc25a UTSW 9 109889742 missense probably benign 0.23
R4386:Cdc25a UTSW 9 109889733 missense probably damaging 1.00
R5074:Cdc25a UTSW 9 109884140 missense possibly damaging 0.46
R5171:Cdc25a UTSW 9 109877161 missense probably benign 0.25
R5896:Cdc25a UTSW 9 109884365 missense probably benign 0.00
R6223:Cdc25a UTSW 9 109889774 missense possibly damaging 0.85
R6240:Cdc25a UTSW 9 109884158 missense probably damaging 1.00
R6440:Cdc25a UTSW 9 109881498 missense probably benign
R6854:Cdc25a UTSW 9 109879927 missense probably damaging 1.00
R7219:Cdc25a UTSW 9 109889086 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGATTAGCTTCTGACTTTATGAAG -3'
(R):5'- TGTAGACTGGAGCAGCACTG -3'

Sequencing Primer
(F):5'- CTGACATAACAGGCAGGTGGTCTAC -3'
(R):5'- ACTGGAGCGCCTTGTGAC -3'
Posted On2017-02-28