Incidental Mutation 'R5928:Xbp1'
ID460028
Institutional Source Beutler Lab
Gene Symbol Xbp1
Ensembl Gene ENSMUSG00000020484
Gene NameX-box binding protein 1
SynonymsXBP-1, D11Ertd39e, TREB-5, TREB5
MMRRC Submission 044123-MU
Accession Numbers

Genbank: NM_013842; MGI: 98970; Ensembl: ENSMUST00000109866

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5928 (G1)
Quality Score215
Status Validated
Chromosome11
Chromosomal Location5520659-5525893 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 5523514 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063084] [ENSMUST00000149623]
Predicted Effect probably benign
Transcript: ENSMUST00000063084
SMART Domains Protein: ENSMUSP00000054852
Gene: ENSMUSG00000020484

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
BRLZ 61 125 9.12e-18 SMART
low complexity region 185 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145588
Predicted Effect probably benign
Transcript: ENSMUST00000149159
SMART Domains Protein: ENSMUSP00000134088
Gene: ENSMUSG00000020484

DomainStartEndE-ValueType
BRLZ 2 57 2.62e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149623
SMART Domains Protein: ENSMUSP00000135768
Gene: ENSMUSG00000020484

DomainStartEndE-ValueType
BRLZ 11 72 3.68e-13 SMART
low complexity region 132 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit markedly impaired liver development resulting in severe anemia, necrosis of cardiac myocytes, morphological abnormalities of the neural tube, and fetal death around embryonic day 14. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(3) Targeted, other(6) Gene trapped(7)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Xbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1601:Xbp1 UTSW 11 5521975 missense probably damaging 1.00
R2256:Xbp1 UTSW 11 5524841 missense probably damaging 1.00
R4647:Xbp1 UTSW 11 5522006 missense probably damaging 1.00
R4782:Xbp1 UTSW 11 5521167 missense probably damaging 1.00
R4964:Xbp1 UTSW 11 5521125 missense probably damaging 0.98
R5367:Xbp1 UTSW 11 5521910 missense probably benign
R5718:Xbp1 UTSW 11 5521903 missense probably benign 0.00
R6038:Xbp1 UTSW 11 5524798 missense probably benign 0.00
R6038:Xbp1 UTSW 11 5524798 missense probably benign 0.00
R6492:Xbp1 UTSW 11 5521005 missense probably benign
R6835:Xbp1 UTSW 11 5521809 start gained probably benign
R6955:Xbp1 UTSW 11 5522018 missense probably null 0.97
R7067:Xbp1 UTSW 11 5524275 missense probably damaging 1.00
R7483:Xbp1 UTSW 11 5521098 missense probably benign 0.02
R7502:Xbp1 UTSW 11 5524683 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCACGGCCTCTTATGTGATTC -3'
(R):5'- TGTGTATAAACCCACACCCATG -3'

Sequencing Primer
(F):5'- CTTATGTGATTCCTTACAGAACCAC -3'
(R):5'- GGAACATCTGCCTGTAATGGTAAC -3'
Posted On2017-02-28