Incidental Mutation 'R5928:Golgb1'
ID460049
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Namegolgi autoantigen, golgin subfamily b, macrogolgin 1
SynonymsGiantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission 044123-MU
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R5928 (G1)
Quality Score213
Status Validated
Chromosome16
Chromosomal Location36875140-36933085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36911987 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 532 (L532S)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
Predicted Effect probably damaging
Transcript: ENSMUST00000039855
AA Change: L573S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: L573S

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114812
AA Change: L532S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: L532S

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36916150 missense probably benign 0.43
R7205:Golgb1 UTSW 16 36875301 missense unknown
R7206:Golgb1 UTSW 16 36913749 missense probably benign 0.41
R7233:Golgb1 UTSW 16 36914758 missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36915951 nonsense probably null
R7367:Golgb1 UTSW 16 36898546 missense probably benign 0.00
R7408:Golgb1 UTSW 16 36898547 missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36912919 missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36915793 missense probably benign 0.03
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTCAATTAAGGCCTTTCTTGG -3'
(R):5'- GATGCCGATCTTTCATGCCTG -3'

Sequencing Primer
(F):5'- CAATTAAGGCCTTTCTTGGTGTTTTG -3'
(R):5'- TCTTCAGCTGCTGGGCC -3'
Posted On2017-02-28