Incidental Mutation 'R5928:Abca17'
ID460053
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 044123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5928 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24318185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 475 (I475L)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: I475L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: I475L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: I475L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: I475L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATGCTCCGCTGCCAACTAC -3'
(R):5'- TAGACTTTGTTGGCGCTAGC -3'

Sequencing Primer
(F):5'- CTGCCAACTACAGGGTGATAGTTAG -3'
(R):5'- AGTGGCCTCAGTTCAATGAC -3'
Posted On2017-02-28