Incidental Mutation 'R5928:Cfap53'
ID460059
Institutional Source Beutler Lab
Gene Symbol Cfap53
Ensembl Gene ENSMUSG00000035394
Gene Namecilia and flagella associated protein 53
Synonyms4933415I03Rik, Ccdc11
MMRRC Submission 044123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5928 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74283090-74359986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74359740 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 512 (P512S)
Ref Sequence ENSEMBL: ENSMUSP00000110545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114895] [ENSMUST00000176435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114895
AA Change: P512S

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110545
Gene: ENSMUSG00000035394
AA Change: P512S

DomainStartEndE-ValueType
low complexity region 131 145 N/A INTRINSIC
Pfam:TPH 160 495 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177407
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. Mutations in this gene are associated with visceral heterotaxy-6, which implicates this gene in determination of left-right asymmetric patterning. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Cfap53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cfap53 APN 18 74305540 nonsense probably null
IGL00667:Cfap53 APN 18 74300192 missense probably damaging 1.00
IGL00917:Cfap53 APN 18 74299296 missense probably benign 0.08
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0048:Cfap53 UTSW 18 74299173 missense probably benign 0.09
R0601:Cfap53 UTSW 18 74300150 missense possibly damaging 0.94
R0939:Cfap53 UTSW 18 74305730 missense probably null 0.72
R1166:Cfap53 UTSW 18 74300180 missense possibly damaging 0.68
R1588:Cfap53 UTSW 18 74307373 missense probably benign
R2105:Cfap53 UTSW 18 74283223 missense possibly damaging 0.73
R2186:Cfap53 UTSW 18 74329505 splice site probably null
R3723:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3724:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3904:Cfap53 UTSW 18 74307374 missense probably damaging 0.99
R5156:Cfap53 UTSW 18 74359767 utr 3 prime probably benign
R5262:Cfap53 UTSW 18 74329459 missense probably benign 0.39
R6405:Cfap53 UTSW 18 74359606 missense probably damaging 1.00
R6653:Cfap53 UTSW 18 74300209 missense probably damaging 0.97
R6675:Cfap53 UTSW 18 74307376 critical splice donor site probably null
R7011:Cfap53 UTSW 18 74329493 missense probably benign 0.13
R7397:Cfap53 UTSW 18 74283223 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCAGATGCAGATTGCCCAC -3'
(R):5'- GCAACCCTCTGTTACCAGAAGC -3'

Sequencing Primer
(F):5'- GATTGCCCACCAGCAGCAG -3'
(R):5'- CAAACTCGGAGAATAAGCG -3'
Posted On2017-02-28