Incidental Mutation 'R5929:Padi2'
ID460079
Institutional Source Beutler Lab
Gene Symbol Padi2
Ensembl Gene ENSMUSG00000028927
Gene Namepeptidyl arginine deiminase, type II
SynonymsPAD type II, Pdi, Pdi2
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5929 (G1)
Quality Score169
Status Validated
Chromosome4
Chromosomal Location140906344-140952586 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 140944537 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030765]
Predicted Effect probably null
Transcript: ENSMUST00000030765
SMART Domains Protein: ENSMUSP00000030765
Gene: ENSMUSG00000028927

DomainStartEndE-ValueType
Pfam:PAD_N 9 122 1.7e-36 PFAM
Pfam:PAD_M 124 282 4e-71 PFAM
Pfam:PAD 292 670 3.8e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140501
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ATP- or calcium ionophore ionomycin-induced citrullination of mast cells or of proteins following induction of EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Padi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Padi2 APN 4 140917637 missense probably benign 0.27
IGL01374:Padi2 APN 4 140933185 missense probably damaging 1.00
IGL01608:Padi2 APN 4 140932230 missense probably damaging 1.00
IGL02085:Padi2 APN 4 140927157 nonsense probably null
IGL02593:Padi2 APN 4 140949842 missense probably damaging 1.00
IGL02668:Padi2 APN 4 140949880 missense probably benign 0.02
IGL03341:Padi2 APN 4 140927113 missense probably benign 0.06
R0116:Padi2 UTSW 4 140926239 missense probably benign 0.00
R2045:Padi2 UTSW 4 140937930 missense probably damaging 1.00
R2079:Padi2 UTSW 4 140933196 missense probably damaging 1.00
R3022:Padi2 UTSW 4 140937988 missense possibly damaging 0.79
R3079:Padi2 UTSW 4 140949878 missense probably damaging 0.99
R3780:Padi2 UTSW 4 140917737 missense probably benign 0.00
R4250:Padi2 UTSW 4 140906546 missense probably damaging 0.97
R4276:Padi2 UTSW 4 140936548 missense possibly damaging 0.93
R4647:Padi2 UTSW 4 140944446 missense probably damaging 1.00
R5058:Padi2 UTSW 4 140932121 missense probably benign 0.00
R5452:Padi2 UTSW 4 140932071 missense probably benign 0.26
R5471:Padi2 UTSW 4 140933208 missense possibly damaging 0.90
R5489:Padi2 UTSW 4 140944488 missense probably damaging 0.99
R5519:Padi2 UTSW 4 140949222 missense probably damaging 1.00
R5666:Padi2 UTSW 4 140949231 missense possibly damaging 0.76
R5793:Padi2 UTSW 4 140933190 missense probably benign 0.04
R5913:Padi2 UTSW 4 140917641 missense probably benign 0.00
R5933:Padi2 UTSW 4 140917641 missense probably benign 0.00
R6478:Padi2 UTSW 4 140917637 missense probably benign 0.00
R6809:Padi2 UTSW 4 140946766 splice site probably null
R7075:Padi2 UTSW 4 140933217 missense probably damaging 0.96
R7313:Padi2 UTSW 4 140932768 missense probably damaging 0.99
R7380:Padi2 UTSW 4 140917686 nonsense probably null
R7391:Padi2 UTSW 4 140937955 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGTCCTTCTGGCATTCTG -3'
(R):5'- GCCCTTCTCTATTTTGAGACAGG -3'

Sequencing Primer
(F):5'- GGCATTCTGGCTACCTCC -3'
(R):5'- TTACATGACCCTGGAGTTAGGACC -3'
Posted On2017-02-28