Incidental Mutation 'R5929:Col4a1'
ID460094
Institutional Source Beutler Lab
Gene Symbol Col4a1
Ensembl Gene ENSMUSG00000031502
Gene Namecollagen, type IV, alpha 1
SynonymsDel(8)Bru44H, Svc, Raw, Del(8)44H, Bru, Col4a-1, alpha1(IV) collagen
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5929 (G1)
Quality Score159
Status Validated
Chromosome8
Chromosomal Location11198423-11312826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11216788 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1140 (T1140S)
Ref Sequence ENSEMBL: ENSMUSP00000147951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033898] [ENSMUST00000209661] [ENSMUST00000209735]
Predicted Effect probably benign
Transcript: ENSMUST00000033898
AA Change: T1140S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502
AA Change: T1140S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130488
Predicted Effect probably benign
Transcript: ENSMUST00000209661
Predicted Effect probably benign
Transcript: ENSMUST00000209735
AA Change: T1140S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of two alpha-1 and one alpha-2 subunits that assembles into a type IV collagen network. This gene is located adjacent to the gene encoding alpha-2 subunit. Mice lacking both the alpha-1 and alpha-2 subunits of collagen IV die in utero due to structural deficiencies in the basement membranes and certain mutations in this gene cause perinatal cerebral hemorrhage and porencephaly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice with ENU induced alleles have various eye and vision defects and may show bruising at birth. Mice carrying the G498V mutation have renal glomerular defects that resolve within the first weeks of life, but show retinal tortuosity, muscular dystrophy, brain hemorrhages, and renal cysts as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Col4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col4a1 APN 8 11240077 splice site probably benign
IGL00503:Col4a1 APN 8 11240076 splice site probably benign
IGL00938:Col4a1 APN 8 11236456 intron probably benign
IGL01295:Col4a1 APN 8 11236075 intron probably benign
IGL01406:Col4a1 APN 8 11218898 missense probably damaging 1.00
IGL01807:Col4a1 APN 8 11247056 utr 5 prime probably benign
IGL01865:Col4a1 APN 8 11201790 utr 3 prime probably benign
IGL02166:Col4a1 APN 8 11244509 unclassified probably benign
IGL02234:Col4a1 APN 8 11216713 missense probably damaging 1.00
IGL02445:Col4a1 APN 8 11233911 intron probably benign
IGL02719:Col4a1 APN 8 11231950 intron probably benign
IGL02817:Col4a1 APN 8 11220259 missense probably damaging 1.00
IGL02821:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02870:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02935:Col4a1 APN 8 11219166 missense probably damaging 1.00
IGL03085:Col4a1 APN 8 11222198 nonsense probably null
Wayne UTSW 8 11209650 missense probably damaging 1.00
IGL03134:Col4a1 UTSW 8 11240069 critical splice acceptor site probably null
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0238:Col4a1 UTSW 8 11218780 splice site probably benign
R0239:Col4a1 UTSW 8 11218780 splice site probably benign
R0268:Col4a1 UTSW 8 11267588 splice site probably benign
R0320:Col4a1 UTSW 8 11242782 splice site probably null
R0402:Col4a1 UTSW 8 11199838 utr 3 prime probably benign
R0483:Col4a1 UTSW 8 11236423 splice site probably benign
R0511:Col4a1 UTSW 8 11208333 critical splice acceptor site probably null
R0544:Col4a1 UTSW 8 11226487 intron probably benign
R0630:Col4a1 UTSW 8 11199889 splice site probably benign
R0648:Col4a1 UTSW 8 11246892 missense unknown
R0733:Col4a1 UTSW 8 11218934 missense possibly damaging 0.46
R0839:Col4a1 UTSW 8 11221015 missense probably damaging 0.96
R0900:Col4a1 UTSW 8 11218014 small deletion probably benign
R0941:Col4a1 UTSW 8 11208296 missense unknown
R1456:Col4a1 UTSW 8 11242829 splice site probably benign
R1728:Col4a1 UTSW 8 11212712 missense possibly damaging 0.81
R1832:Col4a1 UTSW 8 11214644 splice site probably benign
R1862:Col4a1 UTSW 8 11226439 intron probably benign
R1955:Col4a1 UTSW 8 11208228 splice site probably null
R2058:Col4a1 UTSW 8 11210792 missense probably damaging 0.96
R2263:Col4a1 UTSW 8 11312586 unclassified probably benign
R2696:Col4a1 UTSW 8 11235092 splice site probably null
R3826:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3828:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3829:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3830:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3923:Col4a1 UTSW 8 11201665 utr 3 prime probably benign
R3980:Col4a1 UTSW 8 11239155 intron probably benign
R4120:Col4a1 UTSW 8 11206263 missense unknown
R4152:Col4a1 UTSW 8 11217227 intron probably null
R4437:Col4a1 UTSW 8 11206387 nonsense probably null
R5237:Col4a1 UTSW 8 11245068 unclassified probably benign
R5362:Col4a1 UTSW 8 11245760 unclassified probably benign
R5488:Col4a1 UTSW 8 11312550 unclassified probably benign
R5489:Col4a1 UTSW 8 11312550 unclassified probably benign
R5864:Col4a1 UTSW 8 11202973 utr 3 prime probably benign
R6159:Col4a1 UTSW 8 11220007 missense probably damaging 1.00
R6261:Col4a1 UTSW 8 11207409 splice site probably null
R6404:Col4a1 UTSW 8 11207409 splice site probably null
R6520:Col4a1 UTSW 8 11219152 missense probably damaging 1.00
R6862:Col4a1 UTSW 8 11202926 utr 3 prime probably benign
R6974:Col4a1 UTSW 8 11312538 unclassified probably benign
R7329:Col4a1 UTSW 8 11226494 critical splice acceptor site probably null
Z1088:Col4a1 UTSW 8 11246859 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGAGACCTCTGTGTTCGATCATC -3'
(R):5'- AAGAGCATTTCAGATATCTCCCTCC -3'

Sequencing Primer
(F):5'- ATCATCATGGCGCTGCAGTC -3'
(R):5'- CCTCTCTGTGCAAGCATTGGG -3'
Posted On2017-02-28