Incidental Mutation 'R5929:Ginm1'
ID460102
Institutional Source Beutler Lab
Gene Symbol Ginm1
Ensembl Gene ENSMUSG00000040006
Gene Nameglycoprotein integral membrane 1
SynonymsBC013529
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7767947-7792824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7774050 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 160 (L160I)
Ref Sequence ENSEMBL: ENSMUSP00000119129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039763] [ENSMUST00000124838]
Predicted Effect probably benign
Transcript: ENSMUST00000039763
AA Change: L160I

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040961
Gene: ENSMUSG00000040006
AA Change: L160I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 260 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124838
AA Change: L160I

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119129
Gene: ENSMUSG00000040006
AA Change: L160I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133796
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Ginm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ginm1 APN 10 7792696 unclassified probably benign
IGL02474:Ginm1 APN 10 7777768 splice site probably benign
IGL02606:Ginm1 APN 10 7770399 missense probably damaging 0.98
R0010:Ginm1 UTSW 10 7775374 splice site probably benign
R0010:Ginm1 UTSW 10 7775374 splice site probably benign
R0052:Ginm1 UTSW 10 7779306 missense possibly damaging 0.92
R0052:Ginm1 UTSW 10 7779306 missense possibly damaging 0.92
R1901:Ginm1 UTSW 10 7775216 critical splice donor site probably null
R2106:Ginm1 UTSW 10 7775326 missense probably damaging 1.00
R5374:Ginm1 UTSW 10 7779314 missense probably damaging 0.99
R6062:Ginm1 UTSW 10 7775333 missense probably benign 0.00
R6102:Ginm1 UTSW 10 7768496 missense probably benign 0.00
R6792:Ginm1 UTSW 10 7773983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGCTACAAAAGTTACTGTTTTG -3'
(R):5'- CACACAGTAGGGCACACAGTAG -3'

Sequencing Primer
(F):5'- GGGGTATCCACGTATCCATATAC -3'
(R):5'- GCACACAGTAGGGCACAGC -3'
Posted On2017-02-28