Incidental Mutation 'R5929:Kif27'
ID460114
Institutional Source Beutler Lab
Gene Symbol Kif27
Ensembl Gene ENSMUSG00000060176
Gene Namekinesin family member 27
Synonyms4930517I18Rik
MMRRC Submission 044124-MU
Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58287502-58359122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58343970 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 452 (A452T)
Ref Sequence ENSEMBL: ENSMUSP00000153598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]
Predicted Effect probably benign
Transcript: ENSMUST00000043605
AA Change: A452T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: A452T

DomainStartEndE-ValueType
KISc 3 349 9.18e-160 SMART
low complexity region 369 385 N/A INTRINSIC
coiled coil region 386 418 N/A INTRINSIC
Blast:KISc 486 566 5e-29 BLAST
coiled coil region 710 790 N/A INTRINSIC
coiled coil region 835 891 N/A INTRINSIC
coiled coil region 916 972 N/A INTRINSIC
low complexity region 993 1008 N/A INTRINSIC
coiled coil region 1010 1078 N/A INTRINSIC
coiled coil region 1186 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224694
Predicted Effect probably benign
Transcript: ENSMUST00000225388
AA Change: A452T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Kif27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kif27 APN 13 58337604 missense probably benign
IGL00421:Kif27 APN 13 58343889 missense probably damaging 1.00
IGL00903:Kif27 APN 13 58344672 missense possibly damaging 0.69
IGL01024:Kif27 APN 13 58288201 missense possibly damaging 0.71
IGL01070:Kif27 APN 13 58344093 missense probably damaging 1.00
IGL01761:Kif27 APN 13 58337645 missense probably benign
IGL02160:Kif27 APN 13 58325998 missense probably damaging 1.00
IGL03162:Kif27 APN 13 58311207 missense probably benign 0.03
P0016:Kif27 UTSW 13 58303452 nonsense probably null
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0481:Kif27 UTSW 13 58311264 splice site probably benign
R0960:Kif27 UTSW 13 58323967 missense probably damaging 0.99
R1015:Kif27 UTSW 13 58320215 missense probably damaging 1.00
R1205:Kif27 UTSW 13 58344205 missense probably benign 0.00
R1478:Kif27 UTSW 13 58303545 missense probably damaging 0.98
R1789:Kif27 UTSW 13 58344008 missense probably damaging 1.00
R1959:Kif27 UTSW 13 58293123 missense probably benign 0.00
R1961:Kif27 UTSW 13 58293123 missense probably benign 0.00
R3508:Kif27 UTSW 13 58313212 missense possibly damaging 0.88
R4168:Kif27 UTSW 13 58345748 missense probably benign 0.01
R4247:Kif27 UTSW 13 58287917 missense probably damaging 0.98
R4307:Kif27 UTSW 13 58344123 missense probably benign 0.00
R4621:Kif27 UTSW 13 58331013 missense probably benign 0.13
R4660:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4661:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4736:Kif27 UTSW 13 58328971 missense probably benign 0.04
R4770:Kif27 UTSW 13 58344377 missense probably damaging 1.00
R4853:Kif27 UTSW 13 58311258 missense probably benign 0.06
R4963:Kif27 UTSW 13 58328994 missense possibly damaging 0.85
R4998:Kif27 UTSW 13 58293143 missense probably damaging 0.98
R5134:Kif27 UTSW 13 58291090 missense possibly damaging 0.80
R5225:Kif27 UTSW 13 58293101 missense possibly damaging 0.88
R5835:Kif27 UTSW 13 58313146 critical splice donor site probably null
R5875:Kif27 UTSW 13 58311104 missense probably benign 0.01
R6175:Kif27 UTSW 13 58311237 missense probably damaging 1.00
R6446:Kif27 UTSW 13 58345716 missense probably damaging 1.00
R6628:Kif27 UTSW 13 58354797 missense probably damaging 1.00
Z1088:Kif27 UTSW 13 58288033 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTTAAACAAGTCCTATCTGTG -3'
(R):5'- TCTCTGGAGGAACAGGTAGCTC -3'

Sequencing Primer
(F):5'- TCCCATTGTCAACAGAGTGG -3'
(R):5'- TCAGCTCCAGGAGGAATGTCTG -3'
Posted On2017-02-28