Incidental Mutation 'R5929:Xpnpep1'
ID460131
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene NameX-prolyl aminopeptidase (aminopeptidase P) 1, soluble
SynonymsD230045I08Rik
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location52943417-53040214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53013489 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 109 (T109A)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182097] [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
Predicted Effect probably damaging
Transcript: ENSMUST00000182097
AA Change: T66A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138473
Gene: ENSMUSG00000025027
AA Change: T66A

DomainStartEndE-ValueType
Pfam:Creatinase_N 9 119 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182887
Predicted Effect probably damaging
Transcript: ENSMUST00000183108
AA Change: T109A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: T109A

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183188
Predicted Effect probably damaging
Transcript: ENSMUST00000183274
AA Change: T109A

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: T109A

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184510
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 53010148 missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52997032 missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 53000393 missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 53002465 critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53025380 missense probably benign
IGL03334:Xpnpep1 APN 19 53010146 missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 53010152 missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 53006353 missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52997863 splice site probably benign
R1543:Xpnpep1 UTSW 19 52991676 missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 53006338 missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 53010133 missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 53006210 missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 53006342 missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3822:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3925:Xpnpep1 UTSW 19 52991697 missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53014622 missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 53006175 missense probably benign
R5184:Xpnpep1 UTSW 19 53013414 missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52995519 missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 53004822 missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52997008 missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52997879 missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53011844 missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53011765 critical splice donor site unknown
R7112:Xpnpep1 UTSW 19 53010107 missense not run
Predicted Primers PCR Primer
(F):5'- TAAGATCCTGGGTCCCCAAAGC -3'
(R):5'- AGCATCCTGGTCATCTAGGC -3'

Sequencing Primer
(F):5'- TGGGTCCCCAAAGCATTCTAC -3'
(R):5'- CTTCAGGACTGCTCTGAGAGAGTC -3'
Posted On2017-02-28