Incidental Mutation 'R5930:Gria2'
ID460145
Institutional Source Beutler Lab
Gene Symbol Gria2
Ensembl Gene ENSMUSG00000033981
Gene Nameglutamate receptor, ionotropic, AMPA2 (alpha 2)
SynonymsGlur2, Glur-2, GluR-B, GluA2, GluR2
MMRRC Submission 044125-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R5930 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location80681450-80802835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80707249 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 495 (I495V)
Ref Sequence ENSEMBL: ENSMUSP00000141447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075316
AA Change: I495V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: I495V

DomainStartEndE-ValueType
Pfam:ANF_receptor 49 379 2.7e-58 PFAM
PBPe 415 790 3.75e-132 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107745
AA Change: I495V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: I495V

DomainStartEndE-ValueType
Pfam:ANF_receptor 47 379 4.8e-53 PFAM
PBPe 415 790 8.16e-133 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192463
AA Change: I495V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: I495V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 47 379 1.7e-51 PFAM
PBPe 415 770 1.2e-105 SMART
Lig_chan-Glu_bd 425 490 2.2e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195062
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (102/109)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,397,451 V5572I probably benign Het
AF366264 T A 8: 13,837,263 D276V probably benign Het
Agap1 C T 1: 89,843,096 T656I probably damaging Het
Als2cl C T 9: 110,887,364 R247W probably damaging Het
Ankfy1 A T 11: 72,712,245 R33S probably benign Het
Ano5 T C 7: 51,585,331 F671L probably damaging Het
Arhgap26 A G 18: 39,150,092 M361V probably damaging Het
Bckdk A G 7: 127,905,973 E175G probably damaging Het
Bptf G T 11: 107,073,196 T1724K probably damaging Het
Btn2a2 T A 13: 23,486,228 I112F probably damaging Het
Cd163l1 C T 7: 140,230,446 P984S probably benign Het
Cln8 T A 8: 14,896,621 W212R probably damaging Het
Cnbd1 T C 4: 18,886,119 E300G probably benign Het
Cnksr3 T C 10: 7,142,993 I173V probably benign Het
Cntn2 T A 1: 132,523,432 D484V probably damaging Het
Cyp4a14 C A 4: 115,491,410 G319V probably damaging Het
Cyp4f37 G A 17: 32,629,983 R275Q possibly damaging Het
Def8 C T 8: 123,460,070 probably benign Het
Dnah10 T C 5: 124,791,791 probably null Het
Dock6 A G 9: 21,824,416 V1012A probably benign Het
Dus3l T A 17: 56,769,579 N586K probably damaging Het
Dyrk2 T A 10: 118,860,268 I362F probably damaging Het
Dyx1c1 T C 9: 72,971,998 V356A probably damaging Het
Erc2 T A 14: 27,776,858 D230E probably damaging Het
Fam102b A T 3: 108,980,152 S265R probably benign Het
Fat1 A G 8: 45,044,036 H4186R probably benign Het
Fbxo44 A G 4: 148,156,595 F179S probably damaging Het
Fech A G 18: 64,478,649 probably null Het
Fer1l5 T A 1: 36,385,173 C289* probably null Het
Fhl5 T A 4: 25,214,756 D7V probably benign Het
Flvcr1 G T 1: 191,009,551 T514K probably damaging Het
Fmo1 A T 1: 162,839,616 probably null Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gli3 A G 13: 15,548,625 Y117C probably damaging Het
Gnao1 A G 8: 93,896,245 D59G probably benign Het
Hnf1b C A 11: 83,863,985 H161Q probably benign Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Itpr3 A T 17: 27,110,921 Q1563L possibly damaging Het
Kctd16 A G 18: 40,530,829 N337S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Krtap4-9 T A 11: 99,785,636 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Mchr1 T C 15: 81,237,843 F265L probably damaging Het
Megf8 T A 7: 25,326,441 Y83* probably null Het
Mettl18 A G 1: 163,997,177 M356V probably null Het
Mrm1 G A 11: 84,819,192 R61W probably damaging Het
Muc4 A T 16: 32,751,705 T528S probably benign Het
Myef2 A T 2: 125,095,731 L530* probably null Het
Nhlrc4 T C 17: 25,943,719 E18G probably benign Het
Nisch C T 14: 31,173,145 V1065I probably benign Het
Nlgn2 C T 11: 69,834,149 R97H probably damaging Het
Nos2 T C 11: 78,937,915 L321S probably damaging Het
Oaz3 T C 3: 94,436,410 M49V possibly damaging Het
Olfm5 A G 7: 104,154,155 V367A probably damaging Het
Olfr130 C A 17: 38,067,750 A193D probably benign Het
Olfr1335 C T 4: 118,809,378 R162H probably benign Het
Olfr564 A T 7: 102,804,274 R265S probably damaging Het
Olfr742 C A 14: 50,515,792 A196D probably benign Het
Olfr77 A G 9: 19,920,910 K234E probably damaging Het
Omd C T 13: 49,589,636 P54L possibly damaging Het
Pard3b T A 1: 61,768,130 probably benign Het
Pcdhb18 A C 18: 37,491,935 I773L possibly damaging Het
Pde11a T C 2: 76,139,831 probably null Het
Pfkfb4 A C 9: 109,030,394 probably benign Het
Phb2 T G 6: 124,715,649 I260S probably damaging Het
Pkd1l1 G A 11: 8,958,969 T345I unknown Het
Pla2g6 T C 15: 79,303,528 probably benign Het
Pou4f2 G A 8: 78,436,391 S5F unknown Het
Ppp1r9a A T 6: 5,157,002 probably null Het
Pramel5 A G 4: 144,272,983 I178T probably benign Het
Prom2 C T 2: 127,530,133 W745* probably null Het
Pros1 T A 16: 62,928,061 N632K probably damaging Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rbm25 T A 12: 83,677,866 H796Q possibly damaging Het
Rnf151 A T 17: 24,718,030 probably null Het
Rps6ka1 A T 4: 133,871,571 L97I probably damaging Het
Sergef T A 7: 46,443,464 T374S probably benign Het
Sh3rf3 G T 10: 59,130,986 G717C probably damaging Het
Slc29a4 C T 5: 142,721,402 T500I possibly damaging Het
Smc1b T A 15: 85,086,121 D977V probably damaging Het
Spata31d1d C T 13: 59,727,015 C902Y probably benign Het
St14 A T 9: 31,103,760 V314D probably damaging Het
Stat3 A T 11: 100,893,670 I602N possibly damaging Het
Stx4a T A 7: 127,846,489 I189N probably damaging Het
Tacc1 A G 8: 25,182,199 S338P probably benign Het
Tcirg1 T A 19: 3,902,424 T315S possibly damaging Het
Tenm4 A T 7: 96,854,719 N1295I probably damaging Het
Tm7sf3 T C 6: 146,603,911 K516E possibly damaging Het
Tmem198b T C 10: 128,801,454 E272G possibly damaging Het
Tnip3 A G 6: 65,605,953 Q237R probably damaging Het
Trim15 C T 17: 36,862,360 probably null Het
Trim30a T A 7: 104,421,450 N252I possibly damaging Het
Ttc39a A G 4: 109,430,878 E227G probably benign Het
Ttll13 A G 7: 80,253,166 E194G probably damaging Het
Upf1 G A 8: 70,344,262 T107I probably benign Het
Vac14 A G 8: 110,710,349 I565V probably damaging Het
Zcchc14 A T 8: 121,611,358 probably benign Het
Other mutations in Gria2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Gria2 APN 3 80710790 missense probably benign 0.12
IGL00832:Gria2 APN 3 80707251 missense probably damaging 1.00
IGL01086:Gria2 APN 3 80692381 missense probably damaging 1.00
IGL01409:Gria2 APN 3 80707697 critical splice donor site probably null
IGL01924:Gria2 APN 3 80710331 missense probably benign 0.13
IGL01999:Gria2 APN 3 80732091 missense probably damaging 1.00
IGL02355:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02362:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02389:Gria2 APN 3 80709422 missense probably benign 0.14
IGL02444:Gria2 APN 3 80702553 missense possibly damaging 0.65
IGL02532:Gria2 APN 3 80706999 missense probably damaging 1.00
IGL02991:Gria2 UTSW 3 80707809 nonsense probably null
R0015:Gria2 UTSW 3 80707767 missense probably damaging 1.00
R0148:Gria2 UTSW 3 80707731 missense probably damaging 1.00
R0201:Gria2 UTSW 3 80707838 missense probably damaging 1.00
R0411:Gria2 UTSW 3 80710858 splice site probably benign
R0551:Gria2 UTSW 3 80732026 splice site probably benign
R0655:Gria2 UTSW 3 80732070 nonsense probably null
R0866:Gria2 UTSW 3 80722024 splice site probably benign
R1393:Gria2 UTSW 3 80707098 missense probably damaging 1.00
R1458:Gria2 UTSW 3 80732045 missense possibly damaging 0.71
R1563:Gria2 UTSW 3 80691397 missense probably damaging 0.96
R1771:Gria2 UTSW 3 80692301 nonsense probably null
R1775:Gria2 UTSW 3 80691338 missense probably benign 0.09
R1902:Gria2 UTSW 3 80722108 missense probably damaging 0.98
R1993:Gria2 UTSW 3 80802357 missense probably benign
R1994:Gria2 UTSW 3 80802357 missense probably benign
R1995:Gria2 UTSW 3 80802357 missense probably benign
R2001:Gria2 UTSW 3 80710805 missense probably benign 0.28
R2389:Gria2 UTSW 3 80702625 missense probably damaging 1.00
R2520:Gria2 UTSW 3 80706962 missense probably damaging 1.00
R2679:Gria2 UTSW 3 80740953 splice site probably benign
R2865:Gria2 UTSW 3 80732085 missense probably benign 0.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R3716:Gria2 UTSW 3 80741004 missense possibly damaging 0.77
R3967:Gria2 UTSW 3 80710777 missense possibly damaging 0.95
R4285:Gria2 UTSW 3 80707662 intron probably benign
R4611:Gria2 UTSW 3 80692492 missense probably damaging 0.99
R4612:Gria2 UTSW 3 80732051 missense probably damaging 1.00
R4616:Gria2 UTSW 3 80706897 missense probably damaging 1.00
R4706:Gria2 UTSW 3 80740990 missense probably benign
R4996:Gria2 UTSW 3 80707141 missense probably damaging 0.99
R5502:Gria2 UTSW 3 80706945 missense probably damaging 1.00
R6142:Gria2 UTSW 3 80801717 missense probably benign 0.13
R6233:Gria2 UTSW 3 80707203 missense probably damaging 0.99
R6317:Gria2 UTSW 3 80741004 missense possibly damaging 0.79
R6453:Gria2 UTSW 3 80740974 missense possibly damaging 0.93
R6526:Gria2 UTSW 3 80692469 missense probably damaging 1.00
R6545:Gria2 UTSW 3 80741144 missense probably damaging 0.99
R6574:Gria2 UTSW 3 80689296 missense probably damaging 0.99
R6720:Gria2 UTSW 3 80802304 missense probably benign 0.37
R7009:Gria2 UTSW 3 80706972 missense probably damaging 1.00
R7049:Gria2 UTSW 3 80689327 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGGGCTAAATCTGCTGACC -3'
(R):5'- AGTCAGATAGGCCAACTATTCGTC -3'

Sequencing Primer
(F):5'- TGCTGACCAGGAATAAAACTACACTG -3'
(R):5'- AGATAGGCCAACTATTCGTCTGACTC -3'
Posted On2017-02-28