Incidental Mutation 'R5930:Bptf'
ID460200
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Namebromodomain PHD finger transcription factor
Synonyms9430093H17Rik, Falz
MMRRC Submission 044125-MU
Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5930 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location107033081-107132127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107073196 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1724 (T1724K)
Ref Sequence ENSEMBL: ENSMUSP00000102374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]
Predicted Effect probably damaging
Transcript: ENSMUST00000057892
AA Change: T1609K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: T1609K

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106762
AA Change: T1661K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: T1661K

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106763
AA Change: T1724K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: T1724K

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (102/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,397,451 V5572I probably benign Het
AF366264 T A 8: 13,837,263 D276V probably benign Het
Agap1 C T 1: 89,843,096 T656I probably damaging Het
Als2cl C T 9: 110,887,364 R247W probably damaging Het
Ankfy1 A T 11: 72,712,245 R33S probably benign Het
Ano5 T C 7: 51,585,331 F671L probably damaging Het
Arhgap26 A G 18: 39,150,092 M361V probably damaging Het
Bckdk A G 7: 127,905,973 E175G probably damaging Het
Btn2a2 T A 13: 23,486,228 I112F probably damaging Het
Cd163l1 C T 7: 140,230,446 P984S probably benign Het
Cln8 T A 8: 14,896,621 W212R probably damaging Het
Cnbd1 T C 4: 18,886,119 E300G probably benign Het
Cnksr3 T C 10: 7,142,993 I173V probably benign Het
Cntn2 T A 1: 132,523,432 D484V probably damaging Het
Cyp4a14 C A 4: 115,491,410 G319V probably damaging Het
Cyp4f37 G A 17: 32,629,983 R275Q possibly damaging Het
Def8 C T 8: 123,460,070 probably benign Het
Dnah10 T C 5: 124,791,791 probably null Het
Dock6 A G 9: 21,824,416 V1012A probably benign Het
Dus3l T A 17: 56,769,579 N586K probably damaging Het
Dyrk2 T A 10: 118,860,268 I362F probably damaging Het
Dyx1c1 T C 9: 72,971,998 V356A probably damaging Het
Erc2 T A 14: 27,776,858 D230E probably damaging Het
Fam102b A T 3: 108,980,152 S265R probably benign Het
Fat1 A G 8: 45,044,036 H4186R probably benign Het
Fbxo44 A G 4: 148,156,595 F179S probably damaging Het
Fech A G 18: 64,478,649 probably null Het
Fer1l5 T A 1: 36,385,173 C289* probably null Het
Fhl5 T A 4: 25,214,756 D7V probably benign Het
Flvcr1 G T 1: 191,009,551 T514K probably damaging Het
Fmo1 A T 1: 162,839,616 probably null Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gli3 A G 13: 15,548,625 Y117C probably damaging Het
Gnao1 A G 8: 93,896,245 D59G probably benign Het
Gria2 T C 3: 80,707,249 I495V possibly damaging Het
Hnf1b C A 11: 83,863,985 H161Q probably benign Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Itpr3 A T 17: 27,110,921 Q1563L possibly damaging Het
Kctd16 A G 18: 40,530,829 N337S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Krtap4-9 T A 11: 99,785,636 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Mchr1 T C 15: 81,237,843 F265L probably damaging Het
Megf8 T A 7: 25,326,441 Y83* probably null Het
Mettl18 A G 1: 163,997,177 M356V probably null Het
Mrm1 G A 11: 84,819,192 R61W probably damaging Het
Muc4 A T 16: 32,751,705 T528S probably benign Het
Myef2 A T 2: 125,095,731 L530* probably null Het
Nhlrc4 T C 17: 25,943,719 E18G probably benign Het
Nisch C T 14: 31,173,145 V1065I probably benign Het
Nlgn2 C T 11: 69,834,149 R97H probably damaging Het
Nos2 T C 11: 78,937,915 L321S probably damaging Het
Oaz3 T C 3: 94,436,410 M49V possibly damaging Het
Olfm5 A G 7: 104,154,155 V367A probably damaging Het
Olfr130 C A 17: 38,067,750 A193D probably benign Het
Olfr1335 C T 4: 118,809,378 R162H probably benign Het
Olfr564 A T 7: 102,804,274 R265S probably damaging Het
Olfr742 C A 14: 50,515,792 A196D probably benign Het
Olfr77 A G 9: 19,920,910 K234E probably damaging Het
Omd C T 13: 49,589,636 P54L possibly damaging Het
Pard3b T A 1: 61,768,130 probably benign Het
Pcdhb18 A C 18: 37,491,935 I773L possibly damaging Het
Pde11a T C 2: 76,139,831 probably null Het
Pfkfb4 A C 9: 109,030,394 probably benign Het
Phb2 T G 6: 124,715,649 I260S probably damaging Het
Pkd1l1 G A 11: 8,958,969 T345I unknown Het
Pla2g6 T C 15: 79,303,528 probably benign Het
Pou4f2 G A 8: 78,436,391 S5F unknown Het
Ppp1r9a A T 6: 5,157,002 probably null Het
Pramel5 A G 4: 144,272,983 I178T probably benign Het
Prom2 C T 2: 127,530,133 W745* probably null Het
Pros1 T A 16: 62,928,061 N632K probably damaging Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rbm25 T A 12: 83,677,866 H796Q possibly damaging Het
Rnf151 A T 17: 24,718,030 probably null Het
Rps6ka1 A T 4: 133,871,571 L97I probably damaging Het
Sergef T A 7: 46,443,464 T374S probably benign Het
Sh3rf3 G T 10: 59,130,986 G717C probably damaging Het
Slc29a4 C T 5: 142,721,402 T500I possibly damaging Het
Smc1b T A 15: 85,086,121 D977V probably damaging Het
Spata31d1d C T 13: 59,727,015 C902Y probably benign Het
St14 A T 9: 31,103,760 V314D probably damaging Het
Stat3 A T 11: 100,893,670 I602N possibly damaging Het
Stx4a T A 7: 127,846,489 I189N probably damaging Het
Tacc1 A G 8: 25,182,199 S338P probably benign Het
Tcirg1 T A 19: 3,902,424 T315S possibly damaging Het
Tenm4 A T 7: 96,854,719 N1295I probably damaging Het
Tm7sf3 T C 6: 146,603,911 K516E possibly damaging Het
Tmem198b T C 10: 128,801,454 E272G possibly damaging Het
Tnip3 A G 6: 65,605,953 Q237R probably damaging Het
Trim15 C T 17: 36,862,360 probably null Het
Trim30a T A 7: 104,421,450 N252I possibly damaging Het
Ttc39a A G 4: 109,430,878 E227G probably benign Het
Ttll13 A G 7: 80,253,166 E194G probably damaging Het
Upf1 G A 8: 70,344,262 T107I probably benign Het
Vac14 A G 8: 110,710,349 I565V probably damaging Het
Zcchc14 A T 8: 121,611,358 probably benign Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 107055279 missense possibly damaging 0.88
IGL00664:Bptf APN 11 107077665 missense possibly damaging 0.78
IGL00705:Bptf APN 11 107095708 splice site probably benign
IGL00796:Bptf APN 11 107054550 missense probably damaging 1.00
IGL00834:Bptf APN 11 107073928 missense possibly damaging 0.59
IGL01155:Bptf APN 11 107080727 missense probably damaging 1.00
IGL01314:Bptf APN 11 107054853 missense probably damaging 1.00
IGL01371:Bptf APN 11 107055907 missense probably benign 0.00
IGL01567:Bptf APN 11 107058774 missense probably damaging 1.00
IGL01794:Bptf APN 11 107053221 critical splice donor site probably null
IGL02108:Bptf APN 11 107074988 missense probably benign 0.45
IGL02367:Bptf APN 11 107073352 missense probably benign
IGL02437:Bptf APN 11 107074695 missense probably benign 0.00
IGL02589:Bptf APN 11 107111531 missense possibly damaging 0.92
IGL02897:Bptf APN 11 107047121 missense probably damaging 1.00
IGL02935:Bptf APN 11 107080799 missense probably damaging 1.00
IGL02954:Bptf APN 11 107054749 missense possibly damaging 0.89
IGL02982:Bptf APN 11 107076674 missense probably damaging 1.00
IGL03109:Bptf APN 11 107061701 missense possibly damaging 0.53
IGL03265:Bptf APN 11 107054628 missense probably benign 0.00
IGL03403:Bptf APN 11 107099733 missense possibly damaging 0.51
IGL03097:Bptf UTSW 11 107077680 missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 107054788 missense probably damaging 0.98
R0066:Bptf UTSW 11 107062136 missense possibly damaging 0.90
R0157:Bptf UTSW 11 107074658 missense possibly damaging 0.89
R0320:Bptf UTSW 11 107072819 missense probably damaging 1.00
R0328:Bptf UTSW 11 107047127 missense probably damaging 1.00
R0402:Bptf UTSW 11 107074114 missense probably damaging 1.00
R0482:Bptf UTSW 11 107081262 missense probably benign 0.13
R0574:Bptf UTSW 11 107076527 missense probably damaging 1.00
R0598:Bptf UTSW 11 107072965 missense probably damaging 0.99
R0599:Bptf UTSW 11 107068382 missense probably damaging 1.00
R0601:Bptf UTSW 11 107061692 missense probably benign 0.04
R0744:Bptf UTSW 11 107110812 critical splice donor site probably null
R0836:Bptf UTSW 11 107110812 critical splice donor site probably null
R0885:Bptf UTSW 11 107043791 missense probably damaging 1.00
R1070:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1252:Bptf UTSW 11 107073251 missense probably benign 0.00
R1370:Bptf UTSW 11 107047094 missense probably damaging 0.99
R1428:Bptf UTSW 11 107073047 missense probably damaging 0.99
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1742:Bptf UTSW 11 107110951 missense probably damaging 1.00
R1816:Bptf UTSW 11 107060579 missense probably damaging 1.00
R1858:Bptf UTSW 11 107073301 missense probably benign 0.00
R1989:Bptf UTSW 11 107074826 missense probably damaging 1.00
R2253:Bptf UTSW 11 107111322 missense probably damaging 1.00
R2392:Bptf UTSW 11 107072747 missense probably damaging 1.00
R2431:Bptf UTSW 11 107047240 missense possibly damaging 0.48
R3022:Bptf UTSW 11 107111637 critical splice acceptor site probably null
R3161:Bptf UTSW 11 107074476 missense probably damaging 1.00
R3686:Bptf UTSW 11 107074198 missense probably benign 0.25
R3687:Bptf UTSW 11 107074198 missense probably benign 0.25
R3688:Bptf UTSW 11 107074198 missense probably benign 0.25
R3787:Bptf UTSW 11 107073827 missense probably damaging 1.00
R3834:Bptf UTSW 11 107073857 missense probably benign 0.05
R3885:Bptf UTSW 11 107074513 missense probably damaging 0.97
R4090:Bptf UTSW 11 107081523 missense probably damaging 0.99
R4398:Bptf UTSW 11 107110844 missense probably damaging 1.00
R4437:Bptf UTSW 11 107074474 missense possibly damaging 0.59
R4514:Bptf UTSW 11 107077692 missense probably damaging 1.00
R4565:Bptf UTSW 11 107073010 missense probably damaging 1.00
R4715:Bptf UTSW 11 107047181 missense probably damaging 1.00
R4748:Bptf UTSW 11 107095880 missense probably damaging 0.96
R4764:Bptf UTSW 11 107043694 missense probably damaging 1.00
R4885:Bptf UTSW 11 107074648 missense probably benign 0.39
R4901:Bptf UTSW 11 107110860 nonsense probably null
R4995:Bptf UTSW 11 107054565 missense probably damaging 0.98
R5057:Bptf UTSW 11 107082528 missense probably damaging 0.98
R5120:Bptf UTSW 11 107073385 missense probably damaging 0.99
R5320:Bptf UTSW 11 107081367 nonsense probably null
R5329:Bptf UTSW 11 107073295 missense probably benign 0.06
R5418:Bptf UTSW 11 107111294 missense probably damaging 1.00
R5461:Bptf UTSW 11 107061764 missense probably damaging 1.00
R5664:Bptf UTSW 11 107073699 missense probably benign 0.01
R5718:Bptf UTSW 11 107111434 missense probably damaging 1.00
R5774:Bptf UTSW 11 107111137 missense probably damaging 1.00
R5851:Bptf UTSW 11 107110862 missense probably damaging 1.00
R5949:Bptf UTSW 11 107111089 missense probably damaging 0.99
R5975:Bptf UTSW 11 107035864 utr 3 prime probably benign
R6027:Bptf UTSW 11 107074945 missense probably damaging 1.00
R6128:Bptf UTSW 11 107074690 missense possibly damaging 0.87
R6337:Bptf UTSW 11 107058779 missense possibly damaging 0.89
R6407:Bptf UTSW 11 107111126 missense probably damaging 1.00
R6470:Bptf UTSW 11 107072767 missense probably damaging 1.00
R6487:Bptf UTSW 11 107077726 missense probably damaging 0.99
R6501:Bptf UTSW 11 107077683 missense probably null 1.00
R6755:Bptf UTSW 11 107047256 missense probably benign 0.27
R6861:Bptf UTSW 11 107062565 missense probably damaging 1.00
R6866:Bptf UTSW 11 107073580 missense probably damaging 1.00
R6879:Bptf UTSW 11 107042690 missense probably benign 0.32
R6927:Bptf UTSW 11 107054595 missense probably damaging 1.00
R6944:Bptf UTSW 11 107080823 missense probably damaging 1.00
R7082:Bptf UTSW 11 107086747 missense probably benign 0.00
R7136:Bptf UTSW 11 107099715 missense probably damaging 1.00
R7162:Bptf UTSW 11 107043631 critical splice donor site probably null
R7171:Bptf UTSW 11 107131407 missense unknown
R7193:Bptf UTSW 11 107054809 nonsense probably null
R7210:Bptf UTSW 11 107054464 nonsense probably null
R7221:Bptf UTSW 11 107054832 missense probably damaging 1.00
R7316:Bptf UTSW 11 107073109 missense probably damaging 1.00
R7316:Bptf UTSW 11 107110914 nonsense probably null
R7422:Bptf UTSW 11 107060558 missense probably damaging 1.00
R7454:Bptf UTSW 11 107044640 missense probably benign 0.03
Z1088:Bptf UTSW 11 107074582 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCACGGTTTTACTCTGC -3'
(R):5'- ATCGGAACTCACTTAGTCAGGTAG -3'

Sequencing Primer
(F):5'- GCTCCTTTACAGAGATGGTATCCAC -3'
(R):5'- CTCACTTAGTCAGGTAGAAGATATGG -3'
Posted On2017-02-28