Incidental Mutation 'R5942:Olfr1098'
ID460322
Institutional Source Beutler Lab
Gene Symbol Olfr1098
Ensembl Gene ENSMUSG00000075169
Gene Nameolfactory receptor 1098
SynonymsMOR206-1, GA_x6K02T2Q125-48410458-48409511
MMRRC Submission 044134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5942 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86920949-86924545 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86923406 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 42 (N42S)
Ref Sequence ENSEMBL: ENSMUSP00000107200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099872] [ENSMUST00000111574]
Predicted Effect probably damaging
Transcript: ENSMUST00000099872
AA Change: N42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097457
Gene: ENSMUSG00000075169
AA Change: N42S

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 7e-29 PFAM
Pfam:7tm_4 140 283 3.3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111574
AA Change: N42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107200
Gene: ENSMUSG00000075169
AA Change: N42S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-52 PFAM
Pfam:7tm_1 41 309 8.1e-20 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.7%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,312,407 V860M probably benign Het
Accs A T 2: 93,836,047 L432M probably damaging Het
Actrt3 T A 3: 30,598,664 N94Y possibly damaging Het
Adamts18 T C 8: 113,777,748 Q80R probably benign Het
Ccr8 G T 9: 120,094,706 V296F probably damaging Het
Cep170 T A 1: 176,756,419 E798V probably damaging Het
Cttnbp2 T A 6: 18,448,440 E73D probably damaging Het
Cyp2a4 A T 7: 26,310,704 probably null Het
Dync2h1 A T 9: 7,117,466 Y41* probably null Het
Enc1 G A 13: 97,246,379 D466N probably benign Het
Enpp1 C A 10: 24,676,068 E138* probably null Het
Ezh2 T C 6: 47,577,582 R27G possibly damaging Het
Fam189a2 A G 19: 23,986,470 V245A probably damaging Het
Fut10 A G 8: 31,201,457 N110S possibly damaging Het
Glt1d1 A T 5: 127,644,470 probably null Het
Gm14393 G A 2: 175,061,896 Q73* probably null Het
Gm6904 G A 14: 59,260,144 P13S probably benign Het
Gpr156 C T 16: 38,004,902 P494S probably benign Het
Has2 T A 15: 56,667,796 K508* probably null Het
Hc A T 2: 35,028,125 C715* probably null Het
Hook2 C T 8: 84,994,780 probably null Het
Klhdc7b A C 15: 89,387,431 I839L probably benign Het
Kndc1 T C 7: 139,936,879 L1584P probably damaging Het
Lamp1 T C 8: 13,173,941 F358L probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mga A G 2: 119,946,959 I1871V probably benign Het
Mgmt T A 7: 137,121,490 D96E probably benign Het
Morc2a C A 11: 3,679,936 T424K probably damaging Het
Myo1g A G 11: 6,514,888 L462P probably damaging Het
Ncaph C A 2: 127,116,688 probably null Het
Nlrc3 A T 16: 3,949,429 D969E probably damaging Het
Nt5c3 A T 6: 56,897,854 probably null Het
Olfr1170 A C 2: 88,224,572 I153M probably benign Het
Olfr1255 G T 2: 89,816,340 E5* probably null Het
Olfr194 A T 16: 59,119,676 Y131* probably null Het
Parp14 C A 16: 35,839,367 M1628I probably damaging Het
Parp8 G T 13: 116,869,433 P693Q probably benign Het
Parp9 A G 16: 35,971,889 D485G possibly damaging Het
Pcdha1 T A 18: 36,930,391 V36D probably damaging Het
Pcdhb5 C T 18: 37,320,785 Q73* probably null Het
Pecam1 G T 11: 106,661,983 probably benign Het
Pex1 A G 5: 3,610,277 I527V probably benign Het
Ppp4r4 T A 12: 103,587,447 V388D possibly damaging Het
Psmc4 C T 7: 28,047,055 V202I probably damaging Het
Ptx3 T G 3: 66,220,063 M1R probably null Het
Rimbp3 A G 16: 17,211,888 T1059A probably benign Het
Rmdn3 G A 2: 119,147,577 A181V probably damaging Het
Rnase10 A T 14: 51,009,278 M38L probably benign Het
Sec16b T A 1: 157,531,350 Y118N probably damaging Het
Sigmar1 T C 4: 41,741,159 T32A probably benign Het
Srcap A G 7: 127,538,008 D954G probably damaging Het
Tfrc A G 16: 32,626,715 N618S possibly damaging Het
Tnrc6a A G 7: 123,186,665 D1028G probably damaging Het
Tns3 A T 11: 8,435,860 D1379E probably damaging Het
Ttn A T 2: 76,750,161 C23463S possibly damaging Het
Ufl1 T C 4: 25,250,619 T745A probably benign Het
Vmn1r231 T A 17: 20,890,155 Y166F possibly damaging Het
Wbp1l C A 19: 46,654,430 T290K probably damaging Het
Wdr25 A G 12: 108,898,466 N179S probably benign Het
Wdr62 G A 7: 30,243,079 Q1035* probably null Het
Yif1a C T 19: 5,091,641 R196C probably damaging Het
Zfp352 A T 4: 90,225,070 K482N probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Olfr1098
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1098 APN 2 86922949 missense probably benign
IGL02547:Olfr1098 APN 2 86923028 missense probably damaging 1.00
IGL02881:Olfr1098 APN 2 86922713 missense possibly damaging 0.94
IGL03073:Olfr1098 APN 2 86923353 missense probably damaging 1.00
R0117:Olfr1098 UTSW 2 86922870 missense probably damaging 1.00
R0808:Olfr1098 UTSW 2 86923451 missense probably damaging 1.00
R1061:Olfr1098 UTSW 2 86922782 missense possibly damaging 0.93
R1471:Olfr1098 UTSW 2 86922578 unclassified probably null
R1571:Olfr1098 UTSW 2 86923445 missense probably benign 0.01
R1680:Olfr1098 UTSW 2 86923161 missense probably benign 0.10
R2341:Olfr1098 UTSW 2 86922638 missense possibly damaging 0.63
R2368:Olfr1098 UTSW 2 86923107 missense probably benign
R3158:Olfr1098 UTSW 2 86922606 missense probably benign
R3425:Olfr1098 UTSW 2 86922606 missense probably benign
R3499:Olfr1098 UTSW 2 86923029 missense possibly damaging 0.94
R4156:Olfr1098 UTSW 2 86922878 missense probably damaging 1.00
R4526:Olfr1098 UTSW 2 86922995 missense possibly damaging 0.90
R5743:Olfr1098 UTSW 2 86923205 missense probably benign 0.01
R6372:Olfr1098 UTSW 2 86923155 missense probably damaging 1.00
R6409:Olfr1098 UTSW 2 86923171 nonsense probably null
R6517:Olfr1098 UTSW 2 86923097 missense probably benign 0.05
R6661:Olfr1098 UTSW 2 86923148 missense probably benign 0.02
R7075:Olfr1098 UTSW 2 86922646 missense possibly damaging 0.88
R7166:Olfr1098 UTSW 2 86922748 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACTGGGTGAAGCATCCCATG -3'
(R):5'- GGGCCAAAATCTTATCATGTACTC -3'

Sequencing Primer
(F):5'- TGGAGGTCAGCGTATTCT -3'
(R):5'- CTCATGAACTCAACTGTAATACTTCC -3'
Posted On2017-02-28