Incidental Mutation 'R5942:Ncaph'
ID460328
Institutional Source Beutler Lab
Gene Symbol Ncaph
Ensembl Gene ENSMUSG00000034906
Gene Namenon-SMC condensin I complex, subunit H
SynonymsA730011O11Rik, HCAP-H, Brrn1
MMRRC Submission 044134-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5942 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127103809-127133954 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 127116688 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110387]
Predicted Effect probably null
Transcript: ENSMUST00000110387
SMART Domains Protein: ENSMUSP00000106017
Gene: ENSMUSG00000034906

DomainStartEndE-ValueType
Pfam:Cnd2 25 729 9e-160 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152806
Predicted Effect probably benign
Transcript: ENSMUST00000175885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177191
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.7%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the barr gene family and a regulatory subunit of the condensin complex. This complex is required for the conversion of interphase chromatin into condensed chromosomes. The protein encoded by this gene is associated with mitotic chromosomes, except during the early phase of chromosome condensation. During interphase, the protein has a distinct punctate nucleolar localization. Alternatively spliced transcript variants encoding different proteins have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice die before E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,312,407 V860M probably benign Het
Accs A T 2: 93,836,047 L432M probably damaging Het
Actrt3 T A 3: 30,598,664 N94Y possibly damaging Het
Adamts18 T C 8: 113,777,748 Q80R probably benign Het
Ccr8 G T 9: 120,094,706 V296F probably damaging Het
Cep170 T A 1: 176,756,419 E798V probably damaging Het
Cttnbp2 T A 6: 18,448,440 E73D probably damaging Het
Cyp2a4 A T 7: 26,310,704 probably null Het
Dync2h1 A T 9: 7,117,466 Y41* probably null Het
Enc1 G A 13: 97,246,379 D466N probably benign Het
Enpp1 C A 10: 24,676,068 E138* probably null Het
Ezh2 T C 6: 47,577,582 R27G possibly damaging Het
Fam189a2 A G 19: 23,986,470 V245A probably damaging Het
Fut10 A G 8: 31,201,457 N110S possibly damaging Het
Glt1d1 A T 5: 127,644,470 probably null Het
Gm14393 G A 2: 175,061,896 Q73* probably null Het
Gm6904 G A 14: 59,260,144 P13S probably benign Het
Gpr156 C T 16: 38,004,902 P494S probably benign Het
Has2 T A 15: 56,667,796 K508* probably null Het
Hc A T 2: 35,028,125 C715* probably null Het
Hook2 C T 8: 84,994,780 probably null Het
Klhdc7b A C 15: 89,387,431 I839L probably benign Het
Kndc1 T C 7: 139,936,879 L1584P probably damaging Het
Lamp1 T C 8: 13,173,941 F358L probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mga A G 2: 119,946,959 I1871V probably benign Het
Mgmt T A 7: 137,121,490 D96E probably benign Het
Morc2a C A 11: 3,679,936 T424K probably damaging Het
Myo1g A G 11: 6,514,888 L462P probably damaging Het
Nlrc3 A T 16: 3,949,429 D969E probably damaging Het
Nt5c3 A T 6: 56,897,854 probably null Het
Olfr1098 T C 2: 86,923,406 N42S probably damaging Het
Olfr1170 A C 2: 88,224,572 I153M probably benign Het
Olfr1255 G T 2: 89,816,340 E5* probably null Het
Olfr194 A T 16: 59,119,676 Y131* probably null Het
Parp14 C A 16: 35,839,367 M1628I probably damaging Het
Parp8 G T 13: 116,869,433 P693Q probably benign Het
Parp9 A G 16: 35,971,889 D485G possibly damaging Het
Pcdha1 T A 18: 36,930,391 V36D probably damaging Het
Pcdhb5 C T 18: 37,320,785 Q73* probably null Het
Pecam1 G T 11: 106,661,983 probably benign Het
Pex1 A G 5: 3,610,277 I527V probably benign Het
Ppp4r4 T A 12: 103,587,447 V388D possibly damaging Het
Psmc4 C T 7: 28,047,055 V202I probably damaging Het
Ptx3 T G 3: 66,220,063 M1R probably null Het
Rimbp3 A G 16: 17,211,888 T1059A probably benign Het
Rmdn3 G A 2: 119,147,577 A181V probably damaging Het
Rnase10 A T 14: 51,009,278 M38L probably benign Het
Sec16b T A 1: 157,531,350 Y118N probably damaging Het
Sigmar1 T C 4: 41,741,159 T32A probably benign Het
Srcap A G 7: 127,538,008 D954G probably damaging Het
Tfrc A G 16: 32,626,715 N618S possibly damaging Het
Tnrc6a A G 7: 123,186,665 D1028G probably damaging Het
Tns3 A T 11: 8,435,860 D1379E probably damaging Het
Ttn A T 2: 76,750,161 C23463S possibly damaging Het
Ufl1 T C 4: 25,250,619 T745A probably benign Het
Vmn1r231 T A 17: 20,890,155 Y166F possibly damaging Het
Wbp1l C A 19: 46,654,430 T290K probably damaging Het
Wdr25 A G 12: 108,898,466 N179S probably benign Het
Wdr62 G A 7: 30,243,079 Q1035* probably null Het
Yif1a C T 19: 5,091,641 R196C probably damaging Het
Zfp352 A T 4: 90,225,070 K482N probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ncaph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Ncaph APN 2 127126105 splice site probably benign
IGL02619:Ncaph APN 2 127127536 missense probably damaging 0.99
IGL02674:Ncaph APN 2 127113576 missense probably damaging 0.98
IGL02679:Ncaph APN 2 127124864 missense possibly damaging 0.95
R2060:Ncaph UTSW 2 127124875 missense probably damaging 1.00
R3508:Ncaph UTSW 2 127127193 missense probably benign 0.33
R4283:Ncaph UTSW 2 127121085 intron probably benign
R4761:Ncaph UTSW 2 127106116 missense probably benign 0.07
R4957:Ncaph UTSW 2 127121257 missense possibly damaging 0.46
R5491:Ncaph UTSW 2 127123675 missense probably benign
R6523:Ncaph UTSW 2 127105889 missense probably damaging 0.97
R7177:Ncaph UTSW 2 127116586 missense probably damaging 1.00
R7188:Ncaph UTSW 2 127122114 missense probably benign 0.09
X0021:Ncaph UTSW 2 127127138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCACCATCTTACCCTTTTG -3'
(R):5'- ACAAAGTCAGTGGCAGGGTC -3'

Sequencing Primer
(F):5'- ACCCTTTTGCCTGGTTTGAG -3'
(R):5'- TTTAGATAGGGTAGCACCATGTAGCC -3'
Posted On2017-02-28