Incidental Mutation 'R5942:Sigmar1'
ID460334
Institutional Source Beutler Lab
Gene Symbol Sigmar1
Ensembl Gene ENSMUSG00000036078
Gene Namesigma non-opioid intracellular receptor 1
SynonymsOprs1, mSigmaR1
MMRRC Submission 044134-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5942 (G1)
Quality Score139
Status Not validated
Chromosome4
Chromosomal Location41738493-41756157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41741159 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 32 (T32A)
Ref Sequence ENSEMBL: ENSMUSP00000071492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059354] [ENSMUST00000071561] [ENSMUST00000108041]
Predicted Effect probably benign
Transcript: ENSMUST00000059354
AA Change: T32A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056027
Gene: ENSMUSG00000036078
AA Change: T32A

DomainStartEndE-ValueType
Pfam:ERG2_Sigma1R 11 217 7.6e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071561
AA Change: T32A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071492
Gene: ENSMUSG00000036078
AA Change: T32A

DomainStartEndE-ValueType
Pfam:ERG2_Sigma1R 7 121 9.2e-46 PFAM
Pfam:ERG2_Sigma1R 117 188 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149647
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.7%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein located in the endoplasmic reticulum. The encoded protein is a receptor that binds several endogenous ligands, including N,N-dimethyltryptamine, progesterone and pregnenolone and a variety of of non-opiate compounds. The encoded protein plays a role in regulating the activity of ion channels, acting as a chaperone and protecting cells from oxidative stress. In humans, this receptor has been associated with Alzheimer's and Parkinson's diseases, stroke and numerous disease conditions such as depression, pain and addiction. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal motor coordination and increased depressive-like behavior. Mice homozygous for a knock-out allele exhibit reduced sponataneous activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,312,407 V860M probably benign Het
Accs A T 2: 93,836,047 L432M probably damaging Het
Actrt3 T A 3: 30,598,664 N94Y possibly damaging Het
Adamts18 T C 8: 113,777,748 Q80R probably benign Het
Ccr8 G T 9: 120,094,706 V296F probably damaging Het
Cep170 T A 1: 176,756,419 E798V probably damaging Het
Cttnbp2 T A 6: 18,448,440 E73D probably damaging Het
Cyp2a4 A T 7: 26,310,704 probably null Het
Dync2h1 A T 9: 7,117,466 Y41* probably null Het
Enc1 G A 13: 97,246,379 D466N probably benign Het
Enpp1 C A 10: 24,676,068 E138* probably null Het
Ezh2 T C 6: 47,577,582 R27G possibly damaging Het
Fam189a2 A G 19: 23,986,470 V245A probably damaging Het
Fut10 A G 8: 31,201,457 N110S possibly damaging Het
Glt1d1 A T 5: 127,644,470 probably null Het
Gm14393 G A 2: 175,061,896 Q73* probably null Het
Gm6904 G A 14: 59,260,144 P13S probably benign Het
Gpr156 C T 16: 38,004,902 P494S probably benign Het
Has2 T A 15: 56,667,796 K508* probably null Het
Hc A T 2: 35,028,125 C715* probably null Het
Hook2 C T 8: 84,994,780 probably null Het
Klhdc7b A C 15: 89,387,431 I839L probably benign Het
Kndc1 T C 7: 139,936,879 L1584P probably damaging Het
Lamp1 T C 8: 13,173,941 F358L probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mga A G 2: 119,946,959 I1871V probably benign Het
Mgmt T A 7: 137,121,490 D96E probably benign Het
Morc2a C A 11: 3,679,936 T424K probably damaging Het
Myo1g A G 11: 6,514,888 L462P probably damaging Het
Ncaph C A 2: 127,116,688 probably null Het
Nlrc3 A T 16: 3,949,429 D969E probably damaging Het
Nt5c3 A T 6: 56,897,854 probably null Het
Olfr1098 T C 2: 86,923,406 N42S probably damaging Het
Olfr1170 A C 2: 88,224,572 I153M probably benign Het
Olfr1255 G T 2: 89,816,340 E5* probably null Het
Olfr194 A T 16: 59,119,676 Y131* probably null Het
Parp14 C A 16: 35,839,367 M1628I probably damaging Het
Parp8 G T 13: 116,869,433 P693Q probably benign Het
Parp9 A G 16: 35,971,889 D485G possibly damaging Het
Pcdha1 T A 18: 36,930,391 V36D probably damaging Het
Pcdhb5 C T 18: 37,320,785 Q73* probably null Het
Pecam1 G T 11: 106,661,983 probably benign Het
Pex1 A G 5: 3,610,277 I527V probably benign Het
Ppp4r4 T A 12: 103,587,447 V388D possibly damaging Het
Psmc4 C T 7: 28,047,055 V202I probably damaging Het
Ptx3 T G 3: 66,220,063 M1R probably null Het
Rimbp3 A G 16: 17,211,888 T1059A probably benign Het
Rmdn3 G A 2: 119,147,577 A181V probably damaging Het
Rnase10 A T 14: 51,009,278 M38L probably benign Het
Sec16b T A 1: 157,531,350 Y118N probably damaging Het
Srcap A G 7: 127,538,008 D954G probably damaging Het
Tfrc A G 16: 32,626,715 N618S possibly damaging Het
Tnrc6a A G 7: 123,186,665 D1028G probably damaging Het
Tns3 A T 11: 8,435,860 D1379E probably damaging Het
Ttn A T 2: 76,750,161 C23463S possibly damaging Het
Ufl1 T C 4: 25,250,619 T745A probably benign Het
Vmn1r231 T A 17: 20,890,155 Y166F possibly damaging Het
Wbp1l C A 19: 46,654,430 T290K probably damaging Het
Wdr25 A G 12: 108,898,466 N179S probably benign Het
Wdr62 G A 7: 30,243,079 Q1035* probably null Het
Yif1a C T 19: 5,091,641 R196C probably damaging Het
Zfp352 A T 4: 90,225,070 K482N probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Sigmar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0390:Sigmar1 UTSW 4 41741243 missense probably benign 0.00
R1538:Sigmar1 UTSW 4 41740845 missense probably benign 0.00
R4680:Sigmar1 UTSW 4 41741251 start codon destroyed probably null 0.05
R6519:Sigmar1 UTSW 4 41739380 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGGCAAGCTCATGGTCCAG -3'
(R):5'- ATGGTTCAATCCAGAGGCG -3'

Sequencing Primer
(F):5'- CCAGCCCTGGTGCAAAAAGG -3'
(R):5'- TTCAATCCAGAGGCGGTGCTAG -3'
Posted On2017-02-28