Incidental Mutation 'R5942:Gpr156'
ID460374
Institutional Source Beutler Lab
Gene Symbol Gpr156
Ensembl Gene ENSMUSG00000046961
Gene NameG protein-coupled receptor 156
SynonymsGababl
MMRRC Submission 044134-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5942 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location37916496-38007530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38004902 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 494 (P494S)
Ref Sequence ENSEMBL: ENSMUSP00000055958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061274]
Predicted Effect probably benign
Transcript: ENSMUST00000061274
AA Change: P494S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000055958
Gene: ENSMUSG00000046961
AA Change: P494S

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:7tm_3 61 313 2.6e-37 PFAM
coiled coil region 353 390 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
low complexity region 681 716 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.7%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G protein-coupled receptors (GPCRs) are a large superfamily of cell surface receptors characterized by 7 helical transmembrane domains, together with N-terminal extracellular and C-terminal intracellular domains.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,312,407 V860M probably benign Het
Accs A T 2: 93,836,047 L432M probably damaging Het
Actrt3 T A 3: 30,598,664 N94Y possibly damaging Het
Adamts18 T C 8: 113,777,748 Q80R probably benign Het
Ccr8 G T 9: 120,094,706 V296F probably damaging Het
Cep170 T A 1: 176,756,419 E798V probably damaging Het
Cttnbp2 T A 6: 18,448,440 E73D probably damaging Het
Cyp2a4 A T 7: 26,310,704 probably null Het
Dync2h1 A T 9: 7,117,466 Y41* probably null Het
Enc1 G A 13: 97,246,379 D466N probably benign Het
Enpp1 C A 10: 24,676,068 E138* probably null Het
Ezh2 T C 6: 47,577,582 R27G possibly damaging Het
Fam189a2 A G 19: 23,986,470 V245A probably damaging Het
Fut10 A G 8: 31,201,457 N110S possibly damaging Het
Glt1d1 A T 5: 127,644,470 probably null Het
Gm14393 G A 2: 175,061,896 Q73* probably null Het
Gm6904 G A 14: 59,260,144 P13S probably benign Het
Has2 T A 15: 56,667,796 K508* probably null Het
Hc A T 2: 35,028,125 C715* probably null Het
Hook2 C T 8: 84,994,780 probably null Het
Klhdc7b A C 15: 89,387,431 I839L probably benign Het
Kndc1 T C 7: 139,936,879 L1584P probably damaging Het
Lamp1 T C 8: 13,173,941 F358L probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mga A G 2: 119,946,959 I1871V probably benign Het
Mgmt T A 7: 137,121,490 D96E probably benign Het
Morc2a C A 11: 3,679,936 T424K probably damaging Het
Myo1g A G 11: 6,514,888 L462P probably damaging Het
Ncaph C A 2: 127,116,688 probably null Het
Nlrc3 A T 16: 3,949,429 D969E probably damaging Het
Nt5c3 A T 6: 56,897,854 probably null Het
Olfr1098 T C 2: 86,923,406 N42S probably damaging Het
Olfr1170 A C 2: 88,224,572 I153M probably benign Het
Olfr1255 G T 2: 89,816,340 E5* probably null Het
Olfr194 A T 16: 59,119,676 Y131* probably null Het
Parp14 C A 16: 35,839,367 M1628I probably damaging Het
Parp8 G T 13: 116,869,433 P693Q probably benign Het
Parp9 A G 16: 35,971,889 D485G possibly damaging Het
Pcdha1 T A 18: 36,930,391 V36D probably damaging Het
Pcdhb5 C T 18: 37,320,785 Q73* probably null Het
Pecam1 G T 11: 106,661,983 probably benign Het
Pex1 A G 5: 3,610,277 I527V probably benign Het
Ppp4r4 T A 12: 103,587,447 V388D possibly damaging Het
Psmc4 C T 7: 28,047,055 V202I probably damaging Het
Ptx3 T G 3: 66,220,063 M1R probably null Het
Rimbp3 A G 16: 17,211,888 T1059A probably benign Het
Rmdn3 G A 2: 119,147,577 A181V probably damaging Het
Rnase10 A T 14: 51,009,278 M38L probably benign Het
Sec16b T A 1: 157,531,350 Y118N probably damaging Het
Sigmar1 T C 4: 41,741,159 T32A probably benign Het
Srcap A G 7: 127,538,008 D954G probably damaging Het
Tfrc A G 16: 32,626,715 N618S possibly damaging Het
Tnrc6a A G 7: 123,186,665 D1028G probably damaging Het
Tns3 A T 11: 8,435,860 D1379E probably damaging Het
Ttn A T 2: 76,750,161 C23463S possibly damaging Het
Ufl1 T C 4: 25,250,619 T745A probably benign Het
Vmn1r231 T A 17: 20,890,155 Y166F possibly damaging Het
Wbp1l C A 19: 46,654,430 T290K probably damaging Het
Wdr25 A G 12: 108,898,466 N179S probably benign Het
Wdr62 G A 7: 30,243,079 Q1035* probably null Het
Yif1a C T 19: 5,091,641 R196C probably damaging Het
Zfp352 A T 4: 90,225,070 K482N probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Gpr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Gpr156 APN 16 37988576 missense probably damaging 1.00
IGL01615:Gpr156 APN 16 37988591 missense probably damaging 1.00
IGL01976:Gpr156 APN 16 37979033 missense probably damaging 0.97
IGL02217:Gpr156 APN 16 38005311 missense probably benign 0.19
IGL02515:Gpr156 APN 16 38005679 missense probably damaging 0.97
IGL02596:Gpr156 APN 16 37978724 missense probably benign 0.00
IGL03068:Gpr156 APN 16 37992129 missense probably damaging 0.99
R0690:Gpr156 UTSW 16 37992141 missense probably damaging 1.00
R1034:Gpr156 UTSW 16 38004726 missense probably benign
R1133:Gpr156 UTSW 16 38005321 missense probably benign 0.10
R1317:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1437:Gpr156 UTSW 16 37988542 missense probably damaging 0.99
R1484:Gpr156 UTSW 16 37992196 missense probably damaging 0.99
R1759:Gpr156 UTSW 16 37948221 missense probably damaging 0.96
R1761:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1998:Gpr156 UTSW 16 37997908 missense possibly damaging 0.57
R2067:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2111:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2509:Gpr156 UTSW 16 37947787 missense probably benign 0.04
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R3839:Gpr156 UTSW 16 37988600 missense probably damaging 0.99
R4492:Gpr156 UTSW 16 37992106 missense probably damaging 0.99
R4988:Gpr156 UTSW 16 37948215 missense possibly damaging 0.71
R5329:Gpr156 UTSW 16 38005448 missense probably benign 0.00
R5361:Gpr156 UTSW 16 38005725 missense probably damaging 0.99
R5386:Gpr156 UTSW 16 37948309 missense possibly damaging 0.93
R5531:Gpr156 UTSW 16 38005257 missense probably benign 0.01
R5886:Gpr156 UTSW 16 37979013 missense probably damaging 1.00
R6345:Gpr156 UTSW 16 37987519 missense probably damaging 1.00
R7247:Gpr156 UTSW 16 37947741 missense probably damaging 1.00
R7353:Gpr156 UTSW 16 37992161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGAATGCCCTGCTGTTTC -3'
(R):5'- CTGAAACCCAGTTTAGATGGGG -3'

Sequencing Primer
(F):5'- GGACTCCCTACACGTTCCAG -3'
(R):5'- GGCTACGGGAAGTGGTACTC -3'
Posted On2017-02-28