Incidental Mutation 'R5943:Ccdc150'
ID460384
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Namecoiled-coil domain containing 150
Synonyms4930511H11Rik
MMRRC Submission 044135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R5943 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54250683-54368727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54300367 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 457 (T457A)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
Predicted Effect probably benign
Transcript: ENSMUST00000027128
AA Change: T457A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: T457A

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
AA Change: T457A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983
AA Change: T457A

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C A 17: 45,517,711 Q671K probably benign Het
Acaa2 A G 18: 74,792,382 H72R probably damaging Het
Acad8 A G 9: 26,999,444 L18P probably benign Het
Acap3 T C 4: 155,899,422 V115A possibly damaging Het
Adamts9 T C 6: 92,903,786 T503A probably benign Het
Adcy1 T C 11: 7,161,337 F876S probably damaging Het
Adgrv1 T C 13: 81,386,866 E5760G probably damaging Het
Ankrd26 A T 6: 118,505,746 I1631K probably damaging Het
Cd163 T C 6: 124,329,602 *1160R probably null Het
Cdc6 T C 11: 98,920,763 S517P probably damaging Het
Cenpf A T 1: 189,659,969 D555E possibly damaging Het
Clcn1 T A 6: 42,292,966 I241N probably damaging Het
Clrn2 A T 5: 45,463,719 I152F probably benign Het
Col4a4 A G 1: 82,525,016 I349T unknown Het
Coq8b T A 7: 27,234,003 F96L probably damaging Het
Cp A T 3: 19,964,306 N58I probably benign Het
Dcst1 A T 3: 89,356,411 probably null Het
Dhrs3 A T 4: 144,919,976 M199L possibly damaging Het
Dido1 A T 2: 180,661,882 S1410T probably benign Het
Dnase1l2 C T 17: 24,442,747 A13T probably damaging Het
Duox1 G A 2: 122,333,435 R861Q probably benign Het
Eya2 A G 2: 165,724,689 H220R probably damaging Het
Fas T G 19: 34,320,587 probably null Het
Fezf1 T A 6: 23,246,949 K295* probably null Het
Gldn T G 9: 54,338,437 I424R possibly damaging Het
Gm9047 T A 6: 29,471,909 L128Q possibly damaging Het
Gnptab T C 10: 88,433,514 V693A probably benign Het
Gsdma A T 11: 98,673,026 T269S probably benign Het
Hectd4 A T 5: 121,322,294 T2209S probably benign Het
Hoxd3 A G 2: 74,746,829 N351S probably benign Het
Itpkc T A 7: 27,212,979 N581I possibly damaging Het
Kank3 G T 17: 33,818,401 E226D probably damaging Het
Krtap5-1 A G 7: 142,297,051 S7P unknown Het
Lrriq3 A G 3: 155,163,950 Y304C probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mdn1 T C 4: 32,678,330 S653P probably damaging Het
Mri1 A T 8: 84,254,319 L194* probably null Het
Mtus1 T C 8: 41,084,265 E138G probably benign Het
Myo3b G A 2: 70,286,941 R906Q probably benign Het
Nckipsd C T 9: 108,812,236 P199S possibly damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr669 T A 7: 104,938,643 I39N possibly damaging Het
Pacsin1 T C 17: 27,706,071 L253P probably damaging Het
Pcca T A 14: 122,658,776 I268N probably damaging Het
Pcdhga8 A G 18: 37,816,512 D327G probably damaging Het
Pcnx4 A G 12: 72,579,458 H1146R probably damaging Het
Pnmal2 T C 7: 16,946,437 S449P probably benign Het
Psmb9 T C 17: 34,184,291 E61G probably damaging Het
Pxylp1 A G 9: 96,839,150 Y101H probably damaging Het
Radil A G 5: 142,485,458 I1044T probably damaging Het
Rnf43 G A 11: 87,731,735 R554H probably damaging Het
Sp5 A T 2: 70,475,315 Q17L probably null Het
Strn C A 17: 78,669,847 V211F probably damaging Het
Sult3a1 A G 10: 33,866,641 D88G probably damaging Het
Trim14 T C 4: 46,522,136 I180M probably benign Het
Tsnax C A 8: 125,024,539 S90* probably null Het
Ttn A G 2: 76,968,436 M498T probably benign Het
Vmn1r198 T A 13: 22,355,197 Y195* probably null Het
Vmn2r70 T C 7: 85,565,991 T112A probably benign Het
Wdr66 A G 5: 123,286,357 T205A probably benign Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Yme1l1 G T 2: 23,168,330 R158L probably damaging Het
Zc2hc1c C A 12: 85,289,709 H47N probably damaging Het
Zc3h10 C A 10: 128,545,527 probably benign Het
Zfp825 T C 13: 74,480,888 R170G probably benign Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGACTCCAACTCTAGTGGAAC -3'
(R):5'- GTTCTCACCTTGAAACATCATTCTG -3'

Sequencing Primer
(F):5'- CCAACTCTAGTGGAACTGATATTTCC -3'
(R):5'- TCTGTATCTCAACTAGAAGGGAAGCC -3'
Posted On2017-02-28