Incidental Mutation 'R5943:Hoxd3'
ID460390
Institutional Source Beutler Lab
Gene Symbol Hoxd3
Ensembl Gene ENSMUSG00000079277
Gene Namehomeobox D3
SynonymsHox-4.1, Hox-5.5
MMRRC Submission 044135-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R5943 (G1)
Quality Score104
Status Not validated
Chromosome2
Chromosomal Location74711927-74748442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74746829 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 351 (N351S)
Ref Sequence ENSEMBL: ENSMUSP00000107614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047830] [ENSMUST00000053932] [ENSMUST00000111982] [ENSMUST00000111983] [ENSMUST00000140666] [ENSMUST00000144544]
Predicted Effect probably benign
Transcript: ENSMUST00000047830
AA Change: N351S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044809
Gene: ENSMUSG00000079277
AA Change: N351S

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053932
SMART Domains Protein: ENSMUSP00000051355
Gene: ENSMUSG00000100642

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 370 431 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100000
Predicted Effect probably benign
Transcript: ENSMUST00000111982
AA Change: N351S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107613
Gene: ENSMUSG00000079277
AA Change: N351S

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111983
AA Change: N351S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107614
Gene: ENSMUSG00000079277
AA Change: N351S

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140666
SMART Domains Protein: ENSMUSP00000134616
Gene: ENSMUSG00000079277

DomainStartEndE-ValueType
HOX 35 97 5.83e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230704
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in the regulation of cell adhesion processes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show partial postnatal lethality, asymmetric rib-sternum attachment, and anterior transformations of the cervical vertebrae I (atlas) and II (axis). Mice homozygous for a different knock-out allele lack the anteriorarch of the atlas and the dens of the axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C A 17: 45,517,711 Q671K probably benign Het
Acaa2 A G 18: 74,792,382 H72R probably damaging Het
Acad8 A G 9: 26,999,444 L18P probably benign Het
Acap3 T C 4: 155,899,422 V115A possibly damaging Het
Adamts9 T C 6: 92,903,786 T503A probably benign Het
Adcy1 T C 11: 7,161,337 F876S probably damaging Het
Adgrv1 T C 13: 81,386,866 E5760G probably damaging Het
Ankrd26 A T 6: 118,505,746 I1631K probably damaging Het
Ccdc150 A G 1: 54,300,367 T457A probably benign Het
Cd163 T C 6: 124,329,602 *1160R probably null Het
Cdc6 T C 11: 98,920,763 S517P probably damaging Het
Cenpf A T 1: 189,659,969 D555E possibly damaging Het
Clcn1 T A 6: 42,292,966 I241N probably damaging Het
Clrn2 A T 5: 45,463,719 I152F probably benign Het
Col4a4 A G 1: 82,525,016 I349T unknown Het
Coq8b T A 7: 27,234,003 F96L probably damaging Het
Cp A T 3: 19,964,306 N58I probably benign Het
Dcst1 A T 3: 89,356,411 probably null Het
Dhrs3 A T 4: 144,919,976 M199L possibly damaging Het
Dido1 A T 2: 180,661,882 S1410T probably benign Het
Dnase1l2 C T 17: 24,442,747 A13T probably damaging Het
Duox1 G A 2: 122,333,435 R861Q probably benign Het
Eya2 A G 2: 165,724,689 H220R probably damaging Het
Fas T G 19: 34,320,587 probably null Het
Fezf1 T A 6: 23,246,949 K295* probably null Het
Gldn T G 9: 54,338,437 I424R possibly damaging Het
Gm9047 T A 6: 29,471,909 L128Q possibly damaging Het
Gnptab T C 10: 88,433,514 V693A probably benign Het
Gsdma A T 11: 98,673,026 T269S probably benign Het
Hectd4 A T 5: 121,322,294 T2209S probably benign Het
Itpkc T A 7: 27,212,979 N581I possibly damaging Het
Kank3 G T 17: 33,818,401 E226D probably damaging Het
Krtap5-1 A G 7: 142,297,051 S7P unknown Het
Lrriq3 A G 3: 155,163,950 Y304C probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mdn1 T C 4: 32,678,330 S653P probably damaging Het
Mri1 A T 8: 84,254,319 L194* probably null Het
Mtus1 T C 8: 41,084,265 E138G probably benign Het
Myo3b G A 2: 70,286,941 R906Q probably benign Het
Nckipsd C T 9: 108,812,236 P199S possibly damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr669 T A 7: 104,938,643 I39N possibly damaging Het
Pacsin1 T C 17: 27,706,071 L253P probably damaging Het
Pcca T A 14: 122,658,776 I268N probably damaging Het
Pcdhga8 A G 18: 37,816,512 D327G probably damaging Het
Pcnx4 A G 12: 72,579,458 H1146R probably damaging Het
Pnmal2 T C 7: 16,946,437 S449P probably benign Het
Psmb9 T C 17: 34,184,291 E61G probably damaging Het
Pxylp1 A G 9: 96,839,150 Y101H probably damaging Het
Radil A G 5: 142,485,458 I1044T probably damaging Het
Rnf43 G A 11: 87,731,735 R554H probably damaging Het
Sp5 A T 2: 70,475,315 Q17L probably null Het
Strn C A 17: 78,669,847 V211F probably damaging Het
Sult3a1 A G 10: 33,866,641 D88G probably damaging Het
Trim14 T C 4: 46,522,136 I180M probably benign Het
Tsnax C A 8: 125,024,539 S90* probably null Het
Ttn A G 2: 76,968,436 M498T probably benign Het
Vmn1r198 T A 13: 22,355,197 Y195* probably null Het
Vmn2r70 T C 7: 85,565,991 T112A probably benign Het
Wdr66 A G 5: 123,286,357 T205A probably benign Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Yme1l1 G T 2: 23,168,330 R158L probably damaging Het
Zc2hc1c C A 12: 85,289,709 H47N probably damaging Het
Zc3h10 C A 10: 128,545,527 probably benign Het
Zfp825 T C 13: 74,480,888 R170G probably benign Het
Other mutations in Hoxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02636:Hoxd3 APN 2 74746954 missense probably benign 0.32
IGL03017:Hoxd3 APN 2 74746706 missense possibly damaging 0.68
candide UTSW 2 74744076 missense probably damaging 1.00
compressed UTSW 2 74744306 nonsense probably null
R1977:Hoxd3 UTSW 2 74744276 missense possibly damaging 0.94
R2079:Hoxd3 UTSW 2 74744266 missense probably damaging 0.97
R2124:Hoxd3 UTSW 2 74744234 missense possibly damaging 0.92
R5143:Hoxd3 UTSW 2 74746372 missense probably damaging 1.00
R5250:Hoxd3 UTSW 2 74744306 nonsense probably null
R5256:Hoxd3 UTSW 2 74746867 missense possibly damaging 0.88
R6300:Hoxd3 UTSW 2 74744076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCATCCTGCATTCTCC -3'
(R):5'- GTGAGCCGAGAGATCTGTGTAG -3'

Sequencing Primer
(F):5'- TGCATTCTCCAGCCGGTCAG -3'
(R):5'- CCGAGAGATCTGTGTAGGTGGG -3'
Posted On2017-02-28