Incidental Mutation 'R5943:Wwc2'
ID460423
Institutional Source Beutler Lab
Gene Symbol Wwc2
Ensembl Gene ENSMUSG00000031563
Gene NameWW, C2 and coiled-coil domain containing 2
SynonymsD8Ertd594e
MMRRC Submission 044135-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R5943 (G1)
Quality Score134
Status Not validated
Chromosome8
Chromosomal Location47823959-47990924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47990102 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 32 (N32S)
Ref Sequence ENSEMBL: ENSMUSP00000056121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057561]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057561
AA Change: N32S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563
AA Change: N32S

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212282
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WW-and-C2-domain-containing family of proteins. Members of this family have two N-terminal WW domains that mediate binding to target proteins harboring L/PPxY motifs, an internal C2 domain for membrane association, and C-terminal alpha protein kinase C binding sites and class III PDZ domain-interaction motifs. Proteins of this family are able to form homo- and heterodimers and to modulate hippo pathway signaling. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C A 17: 45,517,711 Q671K probably benign Het
Acaa2 A G 18: 74,792,382 H72R probably damaging Het
Acad8 A G 9: 26,999,444 L18P probably benign Het
Acap3 T C 4: 155,899,422 V115A possibly damaging Het
Adamts9 T C 6: 92,903,786 T503A probably benign Het
Adcy1 T C 11: 7,161,337 F876S probably damaging Het
Adgrv1 T C 13: 81,386,866 E5760G probably damaging Het
Ankrd26 A T 6: 118,505,746 I1631K probably damaging Het
Ccdc150 A G 1: 54,300,367 T457A probably benign Het
Cd163 T C 6: 124,329,602 *1160R probably null Het
Cdc6 T C 11: 98,920,763 S517P probably damaging Het
Cenpf A T 1: 189,659,969 D555E possibly damaging Het
Clcn1 T A 6: 42,292,966 I241N probably damaging Het
Clrn2 A T 5: 45,463,719 I152F probably benign Het
Col4a4 A G 1: 82,525,016 I349T unknown Het
Coq8b T A 7: 27,234,003 F96L probably damaging Het
Cp A T 3: 19,964,306 N58I probably benign Het
Dcst1 A T 3: 89,356,411 probably null Het
Dhrs3 A T 4: 144,919,976 M199L possibly damaging Het
Dido1 A T 2: 180,661,882 S1410T probably benign Het
Dnase1l2 C T 17: 24,442,747 A13T probably damaging Het
Duox1 G A 2: 122,333,435 R861Q probably benign Het
Eya2 A G 2: 165,724,689 H220R probably damaging Het
Fas T G 19: 34,320,587 probably null Het
Fezf1 T A 6: 23,246,949 K295* probably null Het
Gldn T G 9: 54,338,437 I424R possibly damaging Het
Gm9047 T A 6: 29,471,909 L128Q possibly damaging Het
Gnptab T C 10: 88,433,514 V693A probably benign Het
Gsdma A T 11: 98,673,026 T269S probably benign Het
Hectd4 A T 5: 121,322,294 T2209S probably benign Het
Hoxd3 A G 2: 74,746,829 N351S probably benign Het
Itpkc T A 7: 27,212,979 N581I possibly damaging Het
Kank3 G T 17: 33,818,401 E226D probably damaging Het
Krtap5-1 A G 7: 142,297,051 S7P unknown Het
Lrriq3 A G 3: 155,163,950 Y304C probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mdn1 T C 4: 32,678,330 S653P probably damaging Het
Mri1 A T 8: 84,254,319 L194* probably null Het
Mtus1 T C 8: 41,084,265 E138G probably benign Het
Myo3b G A 2: 70,286,941 R906Q probably benign Het
Nckipsd C T 9: 108,812,236 P199S possibly damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr669 T A 7: 104,938,643 I39N possibly damaging Het
Pacsin1 T C 17: 27,706,071 L253P probably damaging Het
Pcca T A 14: 122,658,776 I268N probably damaging Het
Pcdhga8 A G 18: 37,816,512 D327G probably damaging Het
Pcnx4 A G 12: 72,579,458 H1146R probably damaging Het
Pnmal2 T C 7: 16,946,437 S449P probably benign Het
Psmb9 T C 17: 34,184,291 E61G probably damaging Het
Pxylp1 A G 9: 96,839,150 Y101H probably damaging Het
Radil A G 5: 142,485,458 I1044T probably damaging Het
Rnf43 G A 11: 87,731,735 R554H probably damaging Het
Sp5 A T 2: 70,475,315 Q17L probably null Het
Strn C A 17: 78,669,847 V211F probably damaging Het
Sult3a1 A G 10: 33,866,641 D88G probably damaging Het
Trim14 T C 4: 46,522,136 I180M probably benign Het
Tsnax C A 8: 125,024,539 S90* probably null Het
Ttn A G 2: 76,968,436 M498T probably benign Het
Vmn1r198 T A 13: 22,355,197 Y195* probably null Het
Vmn2r70 T C 7: 85,565,991 T112A probably benign Het
Wdr66 A G 5: 123,286,357 T205A probably benign Het
Yme1l1 G T 2: 23,168,330 R158L probably damaging Het
Zc2hc1c C A 12: 85,289,709 H47N probably damaging Het
Zc3h10 C A 10: 128,545,527 probably benign Het
Zfp825 T C 13: 74,480,888 R170G probably benign Het
Other mutations in Wwc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Wwc2 APN 8 47846158 missense unknown
IGL01397:Wwc2 APN 8 47868276 missense unknown
IGL01522:Wwc2 APN 8 47868633 missense unknown
IGL01530:Wwc2 APN 8 47863939 missense unknown
IGL01867:Wwc2 APN 8 47883580 missense probably benign 0.02
IGL01991:Wwc2 APN 8 47869866 nonsense probably null
IGL02092:Wwc2 APN 8 47864535 missense unknown
IGL02320:Wwc2 APN 8 47863847 splice site probably null
IGL02503:Wwc2 APN 8 47849383 missense unknown
H8562:Wwc2 UTSW 8 47920666 missense possibly damaging 0.77
R0244:Wwc2 UTSW 8 47900721 missense probably benign 0.16
R0331:Wwc2 UTSW 8 47880204 missense probably benign 0.15
R0349:Wwc2 UTSW 8 47868666 missense unknown
R0542:Wwc2 UTSW 8 47868379 missense unknown
R0645:Wwc2 UTSW 8 47900639 splice site probably benign
R1081:Wwc2 UTSW 8 47828764 unclassified probably benign
R1167:Wwc2 UTSW 8 47858779 nonsense probably null
R1646:Wwc2 UTSW 8 47842902 missense unknown
R1860:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R2070:Wwc2 UTSW 8 47868321 missense unknown
R2183:Wwc2 UTSW 8 47842926 missense unknown
R3969:Wwc2 UTSW 8 47856323 missense unknown
R4096:Wwc2 UTSW 8 47842902 missense unknown
R4387:Wwc2 UTSW 8 47831646 missense unknown
R4447:Wwc2 UTSW 8 47868667 missense unknown
R4448:Wwc2 UTSW 8 47868667 missense unknown
R4450:Wwc2 UTSW 8 47868667 missense unknown
R4646:Wwc2 UTSW 8 47920601 missense probably damaging 1.00
R4869:Wwc2 UTSW 8 47920678 missense probably damaging 0.99
R5159:Wwc2 UTSW 8 47900761 missense probably benign 0.03
R5317:Wwc2 UTSW 8 47847555 missense unknown
R5391:Wwc2 UTSW 8 47863871 missense unknown
R5728:Wwc2 UTSW 8 47864061 missense unknown
R5871:Wwc2 UTSW 8 47868423 missense unknown
R6137:Wwc2 UTSW 8 47856263 missense unknown
R6169:Wwc2 UTSW 8 47858843 missense unknown
R6363:Wwc2 UTSW 8 47887162 splice site probably null
R6421:Wwc2 UTSW 8 47900746 missense probably damaging 1.00
R6467:Wwc2 UTSW 8 47851908 missense unknown
R6712:Wwc2 UTSW 8 47900803 missense probably benign 0.42
R6765:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6766:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6767:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6768:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6782:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6993:Wwc2 UTSW 8 47847465 missense unknown
R7016:Wwc2 UTSW 8 47847548 missense unknown
R7079:Wwc2 UTSW 8 47847545 missense unknown
R7219:Wwc2 UTSW 8 47858884 missense unknown
R7258:Wwc2 UTSW 8 47842999 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGTCTACAAGTCCCCGAG -3'
(R):5'- CAGACATGGTGGACTGATCTC -3'

Sequencing Primer
(F):5'- AGATACAGCCGCGCCTAG -3'
(R):5'- TGGACTGATCTCCGGCAG -3'
Posted On2017-02-28