Incidental Mutation 'R5943:Tsnax'
ID460425
Institutional Source Beutler Lab
Gene Symbol Tsnax
Ensembl Gene ENSMUSG00000056820
Gene Nametranslin-associated factor X
SynonymsTrax
MMRRC Submission 044135-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R5943 (G1)
Quality Score191
Status Not validated
Chromosome8
Chromosomal Location125012997-125034192 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 125024539 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 90 (S90*)
Ref Sequence ENSEMBL: ENSMUSP00000148470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075896] [ENSMUST00000212603]
Predicted Effect probably null
Transcript: ENSMUST00000075896
AA Change: S90*
SMART Domains Protein: ENSMUSP00000075290
Gene: ENSMUSG00000056820
AA Change: S90*

DomainStartEndE-ValueType
Pfam:Translin 51 264 4.2e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212603
AA Change: S90*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which specifically interacts with translin, a DNA-binding protein that binds consensus sequences at breakpoint junctions of chromosomal translocations. The encoded protein contains bipartite nuclear targeting sequences that may provide nuclear transport for translin, which lacks any nuclear targeting motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C A 17: 45,517,711 Q671K probably benign Het
Acaa2 A G 18: 74,792,382 H72R probably damaging Het
Acad8 A G 9: 26,999,444 L18P probably benign Het
Acap3 T C 4: 155,899,422 V115A possibly damaging Het
Adamts9 T C 6: 92,903,786 T503A probably benign Het
Adcy1 T C 11: 7,161,337 F876S probably damaging Het
Adgrv1 T C 13: 81,386,866 E5760G probably damaging Het
Ankrd26 A T 6: 118,505,746 I1631K probably damaging Het
Ccdc150 A G 1: 54,300,367 T457A probably benign Het
Cd163 T C 6: 124,329,602 *1160R probably null Het
Cdc6 T C 11: 98,920,763 S517P probably damaging Het
Cenpf A T 1: 189,659,969 D555E possibly damaging Het
Clcn1 T A 6: 42,292,966 I241N probably damaging Het
Clrn2 A T 5: 45,463,719 I152F probably benign Het
Col4a4 A G 1: 82,525,016 I349T unknown Het
Coq8b T A 7: 27,234,003 F96L probably damaging Het
Cp A T 3: 19,964,306 N58I probably benign Het
Dcst1 A T 3: 89,356,411 probably null Het
Dhrs3 A T 4: 144,919,976 M199L possibly damaging Het
Dido1 A T 2: 180,661,882 S1410T probably benign Het
Dnase1l2 C T 17: 24,442,747 A13T probably damaging Het
Duox1 G A 2: 122,333,435 R861Q probably benign Het
Eya2 A G 2: 165,724,689 H220R probably damaging Het
Fas T G 19: 34,320,587 probably null Het
Fezf1 T A 6: 23,246,949 K295* probably null Het
Gldn T G 9: 54,338,437 I424R possibly damaging Het
Gm9047 T A 6: 29,471,909 L128Q possibly damaging Het
Gnptab T C 10: 88,433,514 V693A probably benign Het
Gsdma A T 11: 98,673,026 T269S probably benign Het
Hectd4 A T 5: 121,322,294 T2209S probably benign Het
Hoxd3 A G 2: 74,746,829 N351S probably benign Het
Itpkc T A 7: 27,212,979 N581I possibly damaging Het
Kank3 G T 17: 33,818,401 E226D probably damaging Het
Krtap5-1 A G 7: 142,297,051 S7P unknown Het
Lrriq3 A G 3: 155,163,950 Y304C probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mdn1 T C 4: 32,678,330 S653P probably damaging Het
Mri1 A T 8: 84,254,319 L194* probably null Het
Mtus1 T C 8: 41,084,265 E138G probably benign Het
Myo3b G A 2: 70,286,941 R906Q probably benign Het
Nckipsd C T 9: 108,812,236 P199S possibly damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr669 T A 7: 104,938,643 I39N possibly damaging Het
Pacsin1 T C 17: 27,706,071 L253P probably damaging Het
Pcca T A 14: 122,658,776 I268N probably damaging Het
Pcdhga8 A G 18: 37,816,512 D327G probably damaging Het
Pcnx4 A G 12: 72,579,458 H1146R probably damaging Het
Pnmal2 T C 7: 16,946,437 S449P probably benign Het
Psmb9 T C 17: 34,184,291 E61G probably damaging Het
Pxylp1 A G 9: 96,839,150 Y101H probably damaging Het
Radil A G 5: 142,485,458 I1044T probably damaging Het
Rnf43 G A 11: 87,731,735 R554H probably damaging Het
Sp5 A T 2: 70,475,315 Q17L probably null Het
Strn C A 17: 78,669,847 V211F probably damaging Het
Sult3a1 A G 10: 33,866,641 D88G probably damaging Het
Trim14 T C 4: 46,522,136 I180M probably benign Het
Ttn A G 2: 76,968,436 M498T probably benign Het
Vmn1r198 T A 13: 22,355,197 Y195* probably null Het
Vmn2r70 T C 7: 85,565,991 T112A probably benign Het
Wdr66 A G 5: 123,286,357 T205A probably benign Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Yme1l1 G T 2: 23,168,330 R158L probably damaging Het
Zc2hc1c C A 12: 85,289,709 H47N probably damaging Het
Zc3h10 C A 10: 128,545,527 probably benign Het
Zfp825 T C 13: 74,480,888 R170G probably benign Het
Other mutations in Tsnax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Tsnax APN 8 125032712 nonsense probably null
R2161:Tsnax UTSW 8 125015689 missense probably damaging 0.99
R4271:Tsnax UTSW 8 125032729 missense probably damaging 1.00
R4700:Tsnax UTSW 8 125028794 missense probably benign 0.22
R5319:Tsnax UTSW 8 125015719 missense probably damaging 1.00
R5472:Tsnax UTSW 8 125015762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCTTCTGTGGCCTCAAGG -3'
(R):5'- TTAAGCCATCATCAGTACCACTTC -3'

Sequencing Primer
(F):5'- CTTGTACAGTGCAGAGCTCTCAAG -3'
(R):5'- TCAGTACCACTTCCAAGGGTG -3'
Posted On2017-02-28