Incidental Mutation 'R5943:Pcnx4'
ID460439
Institutional Source Beutler Lab
Gene Symbol Pcnx4
Ensembl Gene ENSMUSG00000034501
Gene Namepecanex homolog 4
Synonyms1810048J11Rik, Pcnxl4
MMRRC Submission 044135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5943 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72536383-72580119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72579458 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1146 (H1146R)
Ref Sequence ENSEMBL: ENSMUSP00000038916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044352]
Predicted Effect probably damaging
Transcript: ENSMUST00000044352
AA Change: H1146R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038916
Gene: ENSMUSG00000034501
AA Change: H1146R

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 247 264 N/A INTRINSIC
transmembrane domain 296 330 N/A INTRINSIC
transmembrane domain 368 390 N/A INTRINSIC
transmembrane domain 400 417 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
transmembrane domain 546 564 N/A INTRINSIC
transmembrane domain 577 599 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Pfam:Pecanex_C 999 1174 4.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222413
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C A 17: 45,517,711 Q671K probably benign Het
Acaa2 A G 18: 74,792,382 H72R probably damaging Het
Acad8 A G 9: 26,999,444 L18P probably benign Het
Acap3 T C 4: 155,899,422 V115A possibly damaging Het
Adamts9 T C 6: 92,903,786 T503A probably benign Het
Adcy1 T C 11: 7,161,337 F876S probably damaging Het
Adgrv1 T C 13: 81,386,866 E5760G probably damaging Het
Ankrd26 A T 6: 118,505,746 I1631K probably damaging Het
Ccdc150 A G 1: 54,300,367 T457A probably benign Het
Cd163 T C 6: 124,329,602 *1160R probably null Het
Cdc6 T C 11: 98,920,763 S517P probably damaging Het
Cenpf A T 1: 189,659,969 D555E possibly damaging Het
Clcn1 T A 6: 42,292,966 I241N probably damaging Het
Clrn2 A T 5: 45,463,719 I152F probably benign Het
Col4a4 A G 1: 82,525,016 I349T unknown Het
Coq8b T A 7: 27,234,003 F96L probably damaging Het
Cp A T 3: 19,964,306 N58I probably benign Het
Dcst1 A T 3: 89,356,411 probably null Het
Dhrs3 A T 4: 144,919,976 M199L possibly damaging Het
Dido1 A T 2: 180,661,882 S1410T probably benign Het
Dnase1l2 C T 17: 24,442,747 A13T probably damaging Het
Duox1 G A 2: 122,333,435 R861Q probably benign Het
Eya2 A G 2: 165,724,689 H220R probably damaging Het
Fas T G 19: 34,320,587 probably null Het
Fezf1 T A 6: 23,246,949 K295* probably null Het
Gldn T G 9: 54,338,437 I424R possibly damaging Het
Gm9047 T A 6: 29,471,909 L128Q possibly damaging Het
Gnptab T C 10: 88,433,514 V693A probably benign Het
Gsdma A T 11: 98,673,026 T269S probably benign Het
Hectd4 A T 5: 121,322,294 T2209S probably benign Het
Hoxd3 A G 2: 74,746,829 N351S probably benign Het
Itpkc T A 7: 27,212,979 N581I possibly damaging Het
Kank3 G T 17: 33,818,401 E226D probably damaging Het
Krtap5-1 A G 7: 142,297,051 S7P unknown Het
Lrriq3 A G 3: 155,163,950 Y304C probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mdn1 T C 4: 32,678,330 S653P probably damaging Het
Mri1 A T 8: 84,254,319 L194* probably null Het
Mtus1 T C 8: 41,084,265 E138G probably benign Het
Myo3b G A 2: 70,286,941 R906Q probably benign Het
Nckipsd C T 9: 108,812,236 P199S possibly damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr669 T A 7: 104,938,643 I39N possibly damaging Het
Pacsin1 T C 17: 27,706,071 L253P probably damaging Het
Pcca T A 14: 122,658,776 I268N probably damaging Het
Pcdhga8 A G 18: 37,816,512 D327G probably damaging Het
Pnmal2 T C 7: 16,946,437 S449P probably benign Het
Psmb9 T C 17: 34,184,291 E61G probably damaging Het
Pxylp1 A G 9: 96,839,150 Y101H probably damaging Het
Radil A G 5: 142,485,458 I1044T probably damaging Het
Rnf43 G A 11: 87,731,735 R554H probably damaging Het
Sp5 A T 2: 70,475,315 Q17L probably null Het
Strn C A 17: 78,669,847 V211F probably damaging Het
Sult3a1 A G 10: 33,866,641 D88G probably damaging Het
Trim14 T C 4: 46,522,136 I180M probably benign Het
Tsnax C A 8: 125,024,539 S90* probably null Het
Ttn A G 2: 76,968,436 M498T probably benign Het
Vmn1r198 T A 13: 22,355,197 Y195* probably null Het
Vmn2r70 T C 7: 85,565,991 T112A probably benign Het
Wdr66 A G 5: 123,286,357 T205A probably benign Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Yme1l1 G T 2: 23,168,330 R158L probably damaging Het
Zc2hc1c C A 12: 85,289,709 H47N probably damaging Het
Zc3h10 C A 10: 128,545,527 probably benign Het
Zfp825 T C 13: 74,480,888 R170G probably benign Het
Other mutations in Pcnx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pcnx4 APN 12 72579365 missense probably damaging 0.97
IGL01160:Pcnx4 APN 12 72579377 missense probably damaging 1.00
IGL01385:Pcnx4 APN 12 72573746 missense probably damaging 1.00
IGL01452:Pcnx4 APN 12 72574400 missense possibly damaging 0.79
IGL01984:Pcnx4 APN 12 72574409 missense probably benign 0.25
IGL02073:Pcnx4 APN 12 72574328 missense possibly damaging 0.92
IGL02726:Pcnx4 APN 12 72574212 missense probably benign 0.12
IGL02824:Pcnx4 APN 12 72555571 missense probably benign 0.02
R0007:Pcnx4 UTSW 12 72555579 missense possibly damaging 0.79
R0158:Pcnx4 UTSW 12 72556302 missense probably benign
R0575:Pcnx4 UTSW 12 72567236 missense probably benign 0.00
R0783:Pcnx4 UTSW 12 72575478 missense probably damaging 1.00
R1420:Pcnx4 UTSW 12 72555986 missense probably benign
R1497:Pcnx4 UTSW 12 72574400 missense probably benign 0.03
R2093:Pcnx4 UTSW 12 72579442 missense probably damaging 1.00
R2241:Pcnx4 UTSW 12 72574154 missense probably damaging 0.99
R2287:Pcnx4 UTSW 12 72575398 missense probably benign 0.05
R2418:Pcnx4 UTSW 12 72556263 missense probably damaging 1.00
R2437:Pcnx4 UTSW 12 72541813 missense probably damaging 1.00
R2509:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2510:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2512:Pcnx4 UTSW 12 72556799 critical splice acceptor site probably null
R3691:Pcnx4 UTSW 12 72573719 missense probably damaging 1.00
R3760:Pcnx4 UTSW 12 72567006 missense probably damaging 1.00
R3949:Pcnx4 UTSW 12 72556302 missense probably benign
R4065:Pcnx4 UTSW 12 72556360 critical splice donor site probably null
R4757:Pcnx4 UTSW 12 72556293 missense probably benign 0.00
R4804:Pcnx4 UTSW 12 72574202 missense probably benign 0.28
R4867:Pcnx4 UTSW 12 72573952 missense probably benign 0.01
R4879:Pcnx4 UTSW 12 72567185 missense probably damaging 1.00
R5108:Pcnx4 UTSW 12 72574081 missense probably benign 0.01
R5350:Pcnx4 UTSW 12 72579364 missense probably damaging 1.00
R5504:Pcnx4 UTSW 12 72574448 missense probably damaging 1.00
R5718:Pcnx4 UTSW 12 72567194 missense possibly damaging 0.49
R6195:Pcnx4 UTSW 12 72556874 missense possibly damaging 0.92
R7134:Pcnx4 UTSW 12 72566976 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTTTCACACTTGCAGGGCG -3'
(R):5'- AAACAGCTTTGCAGACCATATGG -3'

Sequencing Primer
(F):5'- ACACTTGCAGGGCGTTTACAC -3'
(R):5'- CTCAGGCATTCTTGGGGCAAAG -3'
Posted On2017-02-28