Incidental Mutation 'R5943:Olfr1504'
ID460455
Institutional Source Beutler Lab
Gene Symbol Olfr1504
Ensembl Gene ENSMUSG00000059105
Gene Nameolfactory receptor 1504
SynonymsMOR212-2, GA_x6K02T2RE5P-4223635-4222688
MMRRC Submission 044135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5943 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13886920-13897928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13887752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 153 (V153I)
Ref Sequence ENSEMBL: ENSMUSP00000146610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078282] [ENSMUST00000209192]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078282
AA Change: V153I

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077400
Gene: ENSMUSG00000059105
AA Change: V153I

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.3e-46 PFAM
Pfam:7tm_1 40 313 1.5e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209192
AA Change: V153I

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C A 17: 45,517,711 Q671K probably benign Het
Acaa2 A G 18: 74,792,382 H72R probably damaging Het
Acad8 A G 9: 26,999,444 L18P probably benign Het
Acap3 T C 4: 155,899,422 V115A possibly damaging Het
Adamts9 T C 6: 92,903,786 T503A probably benign Het
Adcy1 T C 11: 7,161,337 F876S probably damaging Het
Adgrv1 T C 13: 81,386,866 E5760G probably damaging Het
Ankrd26 A T 6: 118,505,746 I1631K probably damaging Het
Ccdc150 A G 1: 54,300,367 T457A probably benign Het
Cd163 T C 6: 124,329,602 *1160R probably null Het
Cdc6 T C 11: 98,920,763 S517P probably damaging Het
Cenpf A T 1: 189,659,969 D555E possibly damaging Het
Clcn1 T A 6: 42,292,966 I241N probably damaging Het
Clrn2 A T 5: 45,463,719 I152F probably benign Het
Col4a4 A G 1: 82,525,016 I349T unknown Het
Coq8b T A 7: 27,234,003 F96L probably damaging Het
Cp A T 3: 19,964,306 N58I probably benign Het
Dcst1 A T 3: 89,356,411 probably null Het
Dhrs3 A T 4: 144,919,976 M199L possibly damaging Het
Dido1 A T 2: 180,661,882 S1410T probably benign Het
Dnase1l2 C T 17: 24,442,747 A13T probably damaging Het
Duox1 G A 2: 122,333,435 R861Q probably benign Het
Eya2 A G 2: 165,724,689 H220R probably damaging Het
Fas T G 19: 34,320,587 probably null Het
Fezf1 T A 6: 23,246,949 K295* probably null Het
Gldn T G 9: 54,338,437 I424R possibly damaging Het
Gm9047 T A 6: 29,471,909 L128Q possibly damaging Het
Gnptab T C 10: 88,433,514 V693A probably benign Het
Gsdma A T 11: 98,673,026 T269S probably benign Het
Hectd4 A T 5: 121,322,294 T2209S probably benign Het
Hoxd3 A G 2: 74,746,829 N351S probably benign Het
Itpkc T A 7: 27,212,979 N581I possibly damaging Het
Kank3 G T 17: 33,818,401 E226D probably damaging Het
Krtap5-1 A G 7: 142,297,051 S7P unknown Het
Lrriq3 A G 3: 155,163,950 Y304C probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mdn1 T C 4: 32,678,330 S653P probably damaging Het
Mri1 A T 8: 84,254,319 L194* probably null Het
Mtus1 T C 8: 41,084,265 E138G probably benign Het
Myo3b G A 2: 70,286,941 R906Q probably benign Het
Nckipsd C T 9: 108,812,236 P199S possibly damaging Het
Olfr669 T A 7: 104,938,643 I39N possibly damaging Het
Pacsin1 T C 17: 27,706,071 L253P probably damaging Het
Pcca T A 14: 122,658,776 I268N probably damaging Het
Pcdhga8 A G 18: 37,816,512 D327G probably damaging Het
Pcnx4 A G 12: 72,579,458 H1146R probably damaging Het
Pnmal2 T C 7: 16,946,437 S449P probably benign Het
Psmb9 T C 17: 34,184,291 E61G probably damaging Het
Pxylp1 A G 9: 96,839,150 Y101H probably damaging Het
Radil A G 5: 142,485,458 I1044T probably damaging Het
Rnf43 G A 11: 87,731,735 R554H probably damaging Het
Sp5 A T 2: 70,475,315 Q17L probably null Het
Strn C A 17: 78,669,847 V211F probably damaging Het
Sult3a1 A G 10: 33,866,641 D88G probably damaging Het
Trim14 T C 4: 46,522,136 I180M probably benign Het
Tsnax C A 8: 125,024,539 S90* probably null Het
Ttn A G 2: 76,968,436 M498T probably benign Het
Vmn1r198 T A 13: 22,355,197 Y195* probably null Het
Vmn2r70 T C 7: 85,565,991 T112A probably benign Het
Wdr66 A G 5: 123,286,357 T205A probably benign Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Yme1l1 G T 2: 23,168,330 R158L probably damaging Het
Zc2hc1c C A 12: 85,289,709 H47N probably damaging Het
Zc3h10 C A 10: 128,545,527 probably benign Het
Zfp825 T C 13: 74,480,888 R170G probably benign Het
Other mutations in Olfr1504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1504 APN 19 13887581 missense probably benign
IGL00885:Olfr1504 APN 19 13888168 missense probably benign 0.17
IGL01084:Olfr1504 APN 19 13887502 missense probably damaging 1.00
IGL01522:Olfr1504 APN 19 13887358 nonsense probably null
IGL01727:Olfr1504 APN 19 13887878 missense probably damaging 0.98
IGL02440:Olfr1504 APN 19 13887859 missense probably damaging 1.00
IGL03342:Olfr1504 APN 19 13887437 missense probably damaging 1.00
R0531:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
R0577:Olfr1504 UTSW 19 13887803 missense probably damaging 1.00
R1028:Olfr1504 UTSW 19 13887795 missense probably damaging 0.97
R1674:Olfr1504 UTSW 19 13887590 missense probably benign 0.01
R3906:Olfr1504 UTSW 19 13887706 missense probably damaging 1.00
R4598:Olfr1504 UTSW 19 13888017 missense probably damaging 1.00
R4658:Olfr1504 UTSW 19 13887548 missense probably benign 0.19
R4676:Olfr1504 UTSW 19 13887401 missense probably damaging 1.00
R5919:Olfr1504 UTSW 19 13887845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCTTGGCTTTCGCTC -3'
(R):5'- GTCATCACTTATGAGCACTGTGC -3'

Sequencing Primer
(F):5'- CTGCTGTACGAATCTTCAGAATAGCC -3'
(R):5'- GCACTGTGCTACCCAGTTC -3'
Posted On2017-02-28