Incidental Mutation 'R5944:Phf3'
ID460458
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene NamePHD finger protein 3
SynonymsAU020177, 2310061N19Rik
MMRRC Submission 044136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5944 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location30802339-30873921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30820704 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 914 (L914P)
Ref Sequence ENSEMBL: ENSMUSP00000139610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191064]
Predicted Effect probably damaging
Transcript: ENSMUST00000088310
AA Change: L914P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: L914P

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186105
Predicted Effect probably damaging
Transcript: ENSMUST00000186733
AA Change: L914P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: L914P

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188847
Predicted Effect probably benign
Transcript: ENSMUST00000191064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191245
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Apol7b A T 15: 77,423,767 V176E probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Cenpj A G 14: 56,553,658 probably null Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Dcaf13 A C 15: 39,146,677 M419L probably benign Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fap T C 2: 62,542,261 Y258C probably damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm5581 T A 6: 131,168,400 noncoding transcript Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt36 G T 11: 100,105,313 A95E probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Spatc1 T C 15: 76,283,938 L199P probably damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat3 C T 11: 100,895,105 A449T probably damaging Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30811847 missense probably damaging 0.99
IGL00704:Phf3 APN 1 30804838 missense probably benign
IGL01147:Phf3 APN 1 30804169 missense probably damaging 1.00
IGL01360:Phf3 APN 1 30808728 missense probably damaging 1.00
IGL01376:Phf3 APN 1 30830485 missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30804305 nonsense probably null
IGL01830:Phf3 APN 1 30814067 nonsense probably null
IGL02108:Phf3 APN 1 30829951 missense probably damaging 1.00
IGL02156:Phf3 APN 1 30808778 missense probably damaging 1.00
IGL02576:Phf3 APN 1 30830036 missense probably benign 0.01
IGL03031:Phf3 APN 1 30804653 missense probably benign 0.00
IGL03334:Phf3 APN 1 30805729 missense probably damaging 0.99
IGL03411:Phf3 APN 1 30804401 missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30805023 utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30816541 missense probably damaging 1.00
R0037:Phf3 UTSW 1 30804918 missense probably benign 0.03
R0052:Phf3 UTSW 1 30808767 missense probably damaging 1.00
R0114:Phf3 UTSW 1 30805443 missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0225:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0715:Phf3 UTSW 1 30811838 missense probably damaging 1.00
R0835:Phf3 UTSW 1 30830551 missense probably benign 0.02
R0848:Phf3 UTSW 1 30863172 missense probably damaging 1.00
R1473:Phf3 UTSW 1 30805940 missense probably damaging 1.00
R1522:Phf3 UTSW 1 30805648 missense probably benign 0.05
R1549:Phf3 UTSW 1 30804842 missense probably benign 0.00
R1555:Phf3 UTSW 1 30805877 missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30811942 missense probably damaging 1.00
R1789:Phf3 UTSW 1 30806206 missense probably damaging 1.00
R1875:Phf3 UTSW 1 30830623 missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R1957:Phf3 UTSW 1 30831520 missense probably damaging 1.00
R2019:Phf3 UTSW 1 30811847 missense probably damaging 0.99
R2259:Phf3 UTSW 1 30804343 missense probably benign 0.20
R2305:Phf3 UTSW 1 30805475 nonsense probably null
R2345:Phf3 UTSW 1 30805351 nonsense probably null
R2424:Phf3 UTSW 1 30806349 missense probably damaging 1.00
R2497:Phf3 UTSW 1 30830014 missense probably damaging 1.00
R2504:Phf3 UTSW 1 30810789 missense probably damaging 1.00
R3522:Phf3 UTSW 1 30805603 missense probably damaging 1.00
R3816:Phf3 UTSW 1 30805753 missense probably damaging 1.00
R4152:Phf3 UTSW 1 30831458 missense probably benign 0.13
R4403:Phf3 UTSW 1 30804409 missense probably damaging 1.00
R4658:Phf3 UTSW 1 30863088 missense probably damaging 1.00
R4663:Phf3 UTSW 1 30821215 missense probably damaging 1.00
R4669:Phf3 UTSW 1 30829946 missense probably damaging 1.00
R4706:Phf3 UTSW 1 30805606 missense probably damaging 1.00
R4757:Phf3 UTSW 1 30820827 missense probably damaging 1.00
R4766:Phf3 UTSW 1 30813939 unclassified probably benign
R4786:Phf3 UTSW 1 30816557 nonsense probably null
R5107:Phf3 UTSW 1 30831485 missense probably benign 0.03
R5155:Phf3 UTSW 1 30824376 missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30803806 missense probably damaging 1.00
R5823:Phf3 UTSW 1 30804683 missense probably damaging 1.00
R5979:Phf3 UTSW 1 30805746 missense probably damaging 1.00
R6007:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R6024:Phf3 UTSW 1 30863226 missense probably damaging 1.00
R6072:Phf3 UTSW 1 30830688 missense probably benign 0.08
R6533:Phf3 UTSW 1 30806318 missense probably damaging 1.00
R6649:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30804630 missense probably damaging 0.97
R6855:Phf3 UTSW 1 30820123 missense probably damaging 1.00
R6862:Phf3 UTSW 1 30813982 missense probably damaging 1.00
R6930:Phf3 UTSW 1 30811877 missense probably damaging 1.00
R7135:Phf3 UTSW 1 30831109 missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30813130 missense probably benign 0.01
R7352:Phf3 UTSW 1 30804326 missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30837158 missense probably damaging 0.96
R7549:Phf3 UTSW 1 30831475 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATCTTCAGGTTTGAATCTGTAAGTC -3'
(R):5'- AATGAACTCTGGGCTCTGGC -3'

Sequencing Primer
(F):5'- TCCTCTCAATGATGGCGGACTAG -3'
(R):5'- GTCTGCATGGATTTCAACTTAGATC -3'
Posted On2017-02-28