Incidental Mutation 'R5944:Gm5581'
ID460474
Institutional Source Beutler Lab
Gene Symbol Gm5581
Ensembl Gene ENSMUSG00000061969
Gene Namepredicted gene 5581
Synonyms
MMRRC Submission 044136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5944 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131166365-131182379 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 131168400 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072940
SMART Domains Protein: ENSMUSP00000072710
Gene: ENSMUSG00000061969

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 285 302 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
PDB:1MEY|G 422 507 4e-15 PDB
Blast:HNHc 445 504 4e-6 BLAST
ZnF_C2H2 509 531 9.73e-4 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 1.98e-4 SMART
ZnF_C2H2 593 615 1.52e-5 SMART
ZnF_C2H2 621 643 9.73e-4 SMART
ZnF_C2H2 649 671 9.36e-6 SMART
ZnF_C2H2 677 699 3.49e-5 SMART
ZnF_C2H2 705 727 9.88e-5 SMART
ZnF_C2H2 733 755 9.88e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204992
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Apol7b A T 15: 77,423,767 V176E probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Cenpj A G 14: 56,553,658 probably null Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Dcaf13 A C 15: 39,146,677 M419L probably benign Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fap T C 2: 62,542,261 Y258C probably damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt36 G T 11: 100,105,313 A95E probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Phf3 A G 1: 30,820,704 L914P probably damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Spatc1 T C 15: 76,283,938 L199P probably damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat3 C T 11: 100,895,105 A449T probably damaging Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Gm5581
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Gm5581 APN 6 131167641 unclassified noncoding transcript
IGL01372:Gm5581 APN 6 131168403 exon noncoding transcript
IGL01630:Gm5581 APN 6 131168296 exon noncoding transcript
IGL01667:Gm5581 APN 6 131167772 unclassified noncoding transcript
IGL02260:Gm5581 APN 6 131167946 unclassified noncoding transcript
IGL03212:Gm5581 APN 6 131181450 exon noncoding transcript
IGL03306:Gm5581 APN 6 131168081 unclassified noncoding transcript
R0366:Gm5581 UTSW 6 131166447 unclassified noncoding transcript
R1764:Gm5581 UTSW 6 131181399 exon noncoding transcript
R1961:Gm5581 UTSW 6 131168162 unclassified noncoding transcript
R2129:Gm5581 UTSW 6 131168284 exon noncoding transcript
R3177:Gm5581 UTSW 6 131166965 unclassified noncoding transcript
R4026:Gm5581 UTSW 6 131167068 unclassified noncoding transcript
R4289:Gm5581 UTSW 6 131167556 unclassified noncoding transcript
R4943:Gm5581 UTSW 6 131167125 unclassified noncoding transcript
R4961:Gm5581 UTSW 6 131167227 unclassified noncoding transcript
R5817:Gm5581 UTSW 6 131167169 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACTGACTTCTTTCAGGGGAAG -3'
(R):5'- GGCAATTCCATCAAATTGTTTCCAG -3'

Sequencing Primer
(F):5'- ACTTCTTTCAGGGGAAGTTAGGGC -3'
(R):5'- GCTCACATTGGTGCTGTT -3'
Posted On2017-02-28