Incidental Mutation 'R5944:Apol7b'
ID460499
Institutional Source Beutler Lab
Gene Symbol Apol7b
Ensembl Gene ENSMUSG00000068252
Gene Nameapolipoprotein L 7b
Synonyms
MMRRC Submission 044136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5944 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77422209-77447492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77423767 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 176 (V176E)
Ref Sequence ENSEMBL: ENSMUSP00000086894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089469] [ENSMUST00000229434]
Predicted Effect probably damaging
Transcript: ENSMUST00000089469
AA Change: V176E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086894
Gene: ENSMUSG00000068252
AA Change: V176E

DomainStartEndE-ValueType
Pfam:ApoL 20 82 7.9e-15 PFAM
Pfam:ApoL 77 367 1.9e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229381
Predicted Effect possibly damaging
Transcript: ENSMUST00000229434
AA Change: V176E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Cenpj A G 14: 56,553,658 probably null Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Dcaf13 A C 15: 39,146,677 M419L probably benign Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fap T C 2: 62,542,261 Y258C probably damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm5581 T A 6: 131,168,400 noncoding transcript Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt36 G T 11: 100,105,313 A95E probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Phf3 A G 1: 30,820,704 L914P probably damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Spatc1 T C 15: 76,283,938 L199P probably damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat3 C T 11: 100,895,105 A449T probably damaging Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Apol7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Apol7b APN 15 77423914 missense probably damaging 1.00
IGL02081:Apol7b APN 15 77423536 missense possibly damaging 0.83
IGL02350:Apol7b APN 15 77423632 missense probably benign 0.05
IGL02357:Apol7b APN 15 77423632 missense probably benign 0.05
R0506:Apol7b UTSW 15 77425528 missense probably benign 0.02
R1187:Apol7b UTSW 15 77423403 missense possibly damaging 0.94
R1433:Apol7b UTSW 15 77425546 missense probably damaging 1.00
R1978:Apol7b UTSW 15 77423339 missense probably damaging 0.99
R2272:Apol7b UTSW 15 77423710 missense probably damaging 1.00
R4012:Apol7b UTSW 15 77424709 missense probably damaging 0.98
R4485:Apol7b UTSW 15 77423666 missense probably benign
R4571:Apol7b UTSW 15 77423534 missense probably benign 0.01
R4823:Apol7b UTSW 15 77427782 utr 5 prime probably benign
R5018:Apol7b UTSW 15 77424716 missense probably benign 0.03
R6514:Apol7b UTSW 15 77423926 missense probably benign 0.00
R6519:Apol7b UTSW 15 77423348 missense probably benign 0.01
R6808:Apol7b UTSW 15 77424673 missense probably damaging 1.00
R6904:Apol7b UTSW 15 77423425 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTCTGGGACCACTCTGATC -3'
(R):5'- AAATGACCCGTGGCACAAG -3'

Sequencing Primer
(F):5'- TGGGACCACTCTGATCCAAAACTTC -3'
(R):5'- CAAGGAAAGGTTCTTGGATGCTTATC -3'
Posted On2017-02-28