Incidental Mutation 'R0564:Top1'
ID46051
Institutional Source Beutler Lab
Gene Symbol Top1
Ensembl Gene ENSMUSG00000070544
Gene Nametopoisomerase (DNA) I
SynonymsD130064I21Rik, Top-1
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160645888-160722764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 160714265 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 548 (R548Q)
Ref Sequence ENSEMBL: ENSMUSP00000105094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109468]
Predicted Effect probably damaging
Transcript: ENSMUST00000109468
AA Change: R548Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: R548Q

DomainStartEndE-ValueType
low complexity region 20 95 N/A INTRINSIC
low complexity region 150 211 N/A INTRINSIC
Blast:TOPEUc 245 321 9e-19 BLAST
low complexity region 323 339 N/A INTRINSIC
TOPEUc 362 739 4.43e-280 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150039
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Top1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Top1 APN 2 160704973 splice site probably null
IGL03083:Top1 APN 2 160703578 missense probably damaging 0.97
IGL03242:Top1 APN 2 160715733 missense probably damaging 1.00
IGL03369:Top1 APN 2 160693727 missense unknown
R0022:Top1 UTSW 2 160702799 missense possibly damaging 0.62
R0449:Top1 UTSW 2 160712708 nonsense probably null
R0501:Top1 UTSW 2 160714159 missense probably damaging 1.00
R0946:Top1 UTSW 2 160712668 nonsense probably null
R0972:Top1 UTSW 2 160721025 missense probably damaging 1.00
R0976:Top1 UTSW 2 160717423 missense possibly damaging 0.86
R1534:Top1 UTSW 2 160714232 missense probably damaging 1.00
R1608:Top1 UTSW 2 160703595 missense probably benign 0.01
R1655:Top1 UTSW 2 160703696 critical splice donor site probably null
R1818:Top1 UTSW 2 160715723 missense probably damaging 1.00
R1937:Top1 UTSW 2 160670122 missense unknown
R2055:Top1 UTSW 2 160702828 splice site probably benign
R2104:Top1 UTSW 2 160704819 missense probably damaging 1.00
R3705:Top1 UTSW 2 160702824 critical splice donor site probably null
R3769:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3770:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3801:Top1 UTSW 2 160702768 missense probably damaging 1.00
R3804:Top1 UTSW 2 160702768 missense probably damaging 1.00
R3928:Top1 UTSW 2 160687749 splice site probably benign
R4598:Top1 UTSW 2 160720965 missense possibly damaging 0.89
R4651:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4652:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4742:Top1 UTSW 2 160703570 critical splice acceptor site probably null
R5523:Top1 UTSW 2 160702775 nonsense probably null
R6292:Top1 UTSW 2 160698141 missense probably benign 0.19
R6724:Top1 UTSW 2 160712696 missense probably damaging 1.00
X0027:Top1 UTSW 2 160721518 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTGACCTACCTACCTACCTACCTAC -3'
(R):5'- GCATGAAATGAGGCACACCATATACCAA -3'

Sequencing Primer
(F):5'- gctgagccatctctctagcc -3'
(R):5'- AGGCACACCATATACCAAATATTATC -3'
Posted On2013-06-11