Incidental Mutation 'R0564:Smap2'
ID46055
Institutional Source Beutler Lab
Gene Symbol Smap2
Ensembl Gene ENSMUSG00000032870
Gene Namesmall ArfGAP 2
SynonymsSmap2, 1810031K02Rik, Smap1l
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0564 (G1)
Quality Score167
Status Validated
Chromosome4
Chromosomal Location120968317-121017247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120976977 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 155 (P155S)
Ref Sequence ENSEMBL: ENSMUSP00000035800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043200]
Predicted Effect probably benign
Transcript: ENSMUST00000043200
AA Change: P155S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035800
Gene: ENSMUSG00000032870
AA Change: P155S

DomainStartEndE-ValueType
ArfGap 13 131 2.06e-44 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 274 293 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199525
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with globozoospermia, asthenozoospermia and abnormal acrosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Smap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Smap2 APN 4 120973198 missense probably damaging 0.99
IGL01727:Smap2 APN 4 120982208 splice site probably benign
IGL02236:Smap2 APN 4 120975390 missense probably benign 0.00
twizzler UTSW 4 120985311 missense probably damaging 1.00
R4567:Smap2 UTSW 4 120985311 missense probably damaging 1.00
R5132:Smap2 UTSW 4 120973173 missense possibly damaging 0.79
R5198:Smap2 UTSW 4 121016787 missense possibly damaging 0.89
R6469:Smap2 UTSW 4 120973085 critical splice donor site probably benign
R6470:Smap2 UTSW 4 120973085 critical splice donor site probably benign
R6472:Smap2 UTSW 4 120973085 critical splice donor site probably benign
R6504:Smap2 UTSW 4 120973085 critical splice donor site probably benign
R6516:Smap2 UTSW 4 120983106 critical splice donor site probably null
R7013:Smap2 UTSW 4 120982168 missense probably damaging 1.00
R7270:Smap2 UTSW 4 120972067 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAGTGCAACAGTGCAGTATG -3'
(R):5'- TGTGGGGTCTGCCTCATTCAGTAAG -3'

Sequencing Primer
(F):5'- GCAGTATGGTTTCAAACCCG -3'
(R):5'- GGTTGCATTTCTGCATCAGAATC -3'
Posted On2013-06-11