Incidental Mutation 'R0564:Sema3e'
ID46060
Institutional Source Beutler Lab
Gene Symbol Sema3e
Ensembl Gene ENSMUSG00000063531
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
SynonymsSemah
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location14025276-14256689 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 14236085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073957]
Predicted Effect probably null
Transcript: ENSMUST00000073957
SMART Domains Protein: ENSMUSP00000073612
Gene: ENSMUSG00000063531

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 58 500 1.85e-194 SMART
PSI 518 573 1.81e-10 SMART
IG 587 673 5.75e-4 SMART
low complexity region 737 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199698
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. This gene encodes a class 4 semaphorin. This gene encodes a class 3 semaphorin. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display abnormal intersomitic vacular development and loss of the normal segmented somite pattern. Homozygous mutants for another allele have Bergmeister papillae on the surface of the optic disc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Sema3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sema3e APN 5 14240572 missense probably damaging 1.00
IGL01068:Sema3e APN 5 14233718 critical splice donor site probably null
IGL01128:Sema3e APN 5 14232115 missense probably damaging 1.00
IGL01134:Sema3e APN 5 14252770 missense probably damaging 1.00
IGL02013:Sema3e APN 5 14230193 missense probably damaging 1.00
IGL02051:Sema3e APN 5 14224310 missense possibly damaging 0.77
IGL02309:Sema3e APN 5 14224390 missense probably damaging 0.98
IGL02636:Sema3e APN 5 14225656 missense probably benign
IGL02702:Sema3e APN 5 14233726 splice site probably benign
IGL03001:Sema3e APN 5 14241043 missense probably benign 0.19
R0011:Sema3e UTSW 5 14144011 nonsense probably null
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0220:Sema3e UTSW 5 14164153 missense possibly damaging 0.56
R1079:Sema3e UTSW 5 14225655 missense probably benign 0.12
R1187:Sema3e UTSW 5 14232084 missense probably damaging 1.00
R1670:Sema3e UTSW 5 14162185 splice site probably benign
R1736:Sema3e UTSW 5 14210376 missense probably damaging 1.00
R3433:Sema3e UTSW 5 14252714 missense probably benign 0.00
R3831:Sema3e UTSW 5 14226482 missense probably damaging 1.00
R4094:Sema3e UTSW 5 14233690 missense probably benign 0.12
R4580:Sema3e UTSW 5 14233703 missense probably damaging 1.00
R4828:Sema3e UTSW 5 14226640 missense probably damaging 1.00
R4855:Sema3e UTSW 5 14230130 missense probably damaging 0.99
R4884:Sema3e UTSW 5 14225565 missense probably damaging 1.00
R4960:Sema3e UTSW 5 14252632 missense possibly damaging 0.93
R5264:Sema3e UTSW 5 14226648 missense probably damaging 1.00
R5389:Sema3e UTSW 5 14236085 critical splice donor site probably benign
R5512:Sema3e UTSW 5 14230180 missense probably damaging 1.00
R5642:Sema3e UTSW 5 14162243 missense probably damaging 1.00
R5647:Sema3e UTSW 5 14225553 missense probably damaging 0.99
R5814:Sema3e UTSW 5 14225666 missense probably benign 0.01
R5993:Sema3e UTSW 5 14224293 missense probably damaging 1.00
R6076:Sema3e UTSW 5 14241086 missense probably benign 0.01
R6906:Sema3e UTSW 5 14240587 missense probably damaging 1.00
X0064:Sema3e UTSW 5 14230142 missense probably benign 0.05
Z1088:Sema3e UTSW 5 14226456 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTCATTCCAGTACACACATGCTCC -3'
(R):5'- ATCTGACTTGTGCCACAGCAGAGG -3'

Sequencing Primer
(F):5'- TTACTTCAGAGACCAGGAATAAGCTG -3'
(R):5'- CTGATCCAATGTAAAGCTGTTGC -3'
Posted On2013-06-11