Incidental Mutation 'R5906:Kcnt1'
ID460600
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Namepotassium channel, subfamily T, member 1
SynonymsC030030G16Rik, Slack, slo2
MMRRC Submission 044103-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R5906 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25863734-25918273 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 25894524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
Predicted Effect probably benign
Transcript: ENSMUST00000037580
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114170
SMART Domains Protein: ENSMUSP00000109807
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 84 103 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Pfam:Ion_trans_2 239 317 4.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114172
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114176
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138568
Predicted Effect probably benign
Transcript: ENSMUST00000171268
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197917
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198204
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200434
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
9130023H24Rik G A 7: 128,236,492 P310S probably benign Het
Abcc10 G T 17: 46,316,559 H652Q probably benign Het
Actl6b A G 5: 137,567,329 I396V possibly damaging Het
Acvr1b T C 15: 101,193,891 probably benign Het
Adamts18 A T 8: 113,709,619 H989Q probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Angptl3 A G 4: 99,037,567 T377A probably benign Het
Ankmy2 G A 12: 36,176,633 V109M probably damaging Het
Anpep G A 7: 79,833,675 A689V probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cacna1d C T 14: 30,096,960 V1213I probably damaging Het
Capn1 A G 19: 6,011,421 F156L possibly damaging Het
Catsperb C A 12: 101,510,462 F408L probably damaging Het
Ccdc146 A T 5: 21,301,352 L697Q possibly damaging Het
Cd163l1 T A 7: 140,228,799 D874E probably damaging Het
Cdc37l1 T A 19: 29,011,986 V281E probably benign Het
Chia1 A T 3: 106,131,988 T465S probably benign Het
Cidec A T 6: 113,428,321 probably null Het
Clcnkb T C 4: 141,412,299 T131A probably benign Het
Clec5a T A 6: 40,581,859 M98L probably benign Het
Cnga1 A T 5: 72,610,858 F162I probably benign Het
Cyp27b1 A T 10: 127,048,398 I40F probably damaging Het
Edrf1 A G 7: 133,663,415 S1027G probably benign Het
Entpd1 C A 19: 40,738,839 A448E probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Etfdh T C 3: 79,604,115 I520V probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gabra4 G A 5: 71,623,910 P386L probably benign Het
Gckr G T 5: 31,306,578 V281L probably damaging Het
Gfy T C 7: 45,177,743 T310A probably benign Het
Gjc2 C A 11: 59,176,841 V272L probably benign Het
Gm13441 G C 2: 31,887,499 silent Het
H2-DMb2 T A 17: 34,148,608 M1K probably null Het
Hipk3 T C 2: 104,471,808 Y13C probably damaging Het
Klhdc7b A G 15: 89,387,156 D747G probably benign Het
Krt78 T A 15: 101,948,595 E359V probably damaging Het
Mast4 T C 13: 102,735,744 D2195G probably benign Het
Matk C T 10: 81,260,919 L188F probably damaging Het
Mcoln2 T C 3: 146,183,741 I399T probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nap1l1 A T 10: 111,491,030 K151* probably null Het
Ncbp3 T A 11: 73,073,501 S426T probably benign Het
Nisch T A 14: 31,172,028 probably null Het
Olfr145 A G 9: 37,897,878 H158R probably damaging Het
Olfr1467 T C 19: 13,365,005 C126R probably damaging Het
Olfr160 A G 9: 37,711,805 I158T probably benign Het
Olfr725 T C 14: 50,034,849 T185A probably benign Het
Peg3 T C 7: 6,717,855 D17G probably damaging Het
Pkd1 G A 17: 24,572,920 V1194M probably benign Het
Pkd1l2 A T 8: 117,029,648 I1615N probably damaging Het
Pkd2 A T 5: 104,477,179 probably null Het
Pkp4 T A 2: 59,305,076 N97K possibly damaging Het
Prrx2 C T 2: 30,879,510 R78C probably damaging Het
Pycr1 T A 11: 120,642,162 I91F probably damaging Het
Rap1a T C 3: 105,737,765 N87S possibly damaging Het
Sbk2 T G 7: 4,957,628 Y181S probably damaging Het
Sec16a A T 2: 26,438,831 H1057Q possibly damaging Het
Sfswap G A 5: 129,542,043 E486K probably benign Het
Shank3 T C 15: 89,548,916 V1213A probably damaging Het
Slfn5 T A 11: 82,957,276 I329K probably benign Het
Slit1 T A 19: 41,606,374 N1186Y probably damaging Het
Ssbp3 A G 4: 107,009,821 probably benign Het
Steap3 T A 1: 120,244,001 I125F probably damaging Het
Synpr C A 14: 13,608,788 probably benign Het
Tom1 T C 8: 75,050,258 L69P probably damaging Het
Traf3ip3 T A 1: 193,198,006 D5V possibly damaging Het
Vmn1r29 G A 6: 58,307,751 S152N probably benign Het
Vmn1r68 T C 7: 10,527,623 I183V probably benign Het
Wdr17 C G 8: 54,639,468 V1094L probably benign Het
Wdr95 A G 5: 149,564,227 I109V possibly damaging Het
Zfp39 T C 11: 58,902,891 D7G probably benign Het
Zfp512 A T 5: 31,480,064 Q443L probably damaging Het
Zfp974 T A 7: 27,910,805 K498N possibly damaging Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25892407 missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25916005 missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25898754 missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25900967 missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25888125 missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25912719 critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25908152 missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25900482 critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25901865 missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25900880 splice site probably benign
IGL02683:Kcnt1 APN 2 25900925 missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25909203 critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25894468 splice site probably benign
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25898264 splice site probably benign
R0294:Kcnt1 UTSW 2 25888110 missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25907628 missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25892496 missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25891243 splice site probably benign
R1364:Kcnt1 UTSW 2 25908094 missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25900385 missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25900469 missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25892360 missense probably benign
R2079:Kcnt1 UTSW 2 25900248 missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25891183 splice site probably benign
R2295:Kcnt1 UTSW 2 25900921 missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25894359 missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25900892 missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25915868 critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25893214 missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25916048 missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25877915 missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25878032 missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25907626 missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25908100 missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25901346 missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25909322 intron probably benign
R5223:Kcnt1 UTSW 2 25903422 missense probably benign
R5243:Kcnt1 UTSW 2 25908074 missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25909277 missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25901909 nonsense probably null
R5888:Kcnt1 UTSW 2 25908110 missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25898401 missense probably damaging 1.00
R5927:Kcnt1 UTSW 2 25909376 intron probably benign
R6160:Kcnt1 UTSW 2 25892383 missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25903385 missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25893180 missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25892510 missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25903597 splice site probably null
R6336:Kcnt1 UTSW 2 25888755 unclassified probably null
R6395:Kcnt1 UTSW 2 25909239 missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25911051 missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25877828 intron probably benign
R7308:Kcnt1 UTSW 2 25900463 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGGTGGCAACTTGAACCTGC -3'
(R):5'- TGTACCTAAGACCCTCTGGAAAG -3'

Sequencing Primer
(F):5'- GGCAACTTGAACCTGCTGACC -3'
(R):5'- CCCTCTGGAAAGGAAAGCCTG -3'
Posted On2017-02-28