Incidental Mutation 'R0564:Apbb2'
ID46061
Institutional Source Beutler Lab
Gene Symbol Apbb2
Ensembl Gene ENSMUSG00000029207
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 2
SynonymsTR2L, Rirl1, Zfra, 2310007D03Rik, FE65L1
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location66298703-66618784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66452250 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 18 (M18K)
Ref Sequence ENSEMBL: ENSMUSP00000124139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087256] [ENSMUST00000159357] [ENSMUST00000159512] [ENSMUST00000159786] [ENSMUST00000160063] [ENSMUST00000160103] [ENSMUST00000160870] [ENSMUST00000161716] [ENSMUST00000161879] [ENSMUST00000162349] [ENSMUST00000162366] [ENSMUST00000162382] [ENSMUST00000162994]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087256
AA Change: M18K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084511
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 3.15e-38 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159357
Predicted Effect probably damaging
Transcript: ENSMUST00000159512
AA Change: M18K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124807
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 292 323 1.06e-7 SMART
PTB 394 538 2.87e-41 SMART
PTB 565 695 2.5e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159786
AA Change: M18K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125211
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 4.29e-40 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160063
AA Change: M18K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123778
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 292 323 6.1e-10 SMART
PTB 415 510 1.3e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160103
AA Change: M18K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160185
Predicted Effect possibly damaging
Transcript: ENSMUST00000160870
AA Change: M18K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123978
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 564 694 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161716
Predicted Effect probably damaging
Transcript: ENSMUST00000161879
AA Change: M18K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000162349
AA Change: M18K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123752
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 558 2.87e-41 SMART
PTB 585 715 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162366
AA Change: M18K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125116
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 563 693 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162382
AA Change: M18K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162401
Predicted Effect probably benign
Transcript: ENSMUST00000162994
AA Change: M18K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201776
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Apbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Apbb2 APN 5 66451512 missense probably damaging 1.00
IGL01615:Apbb2 APN 5 66307701 missense probably benign 0.06
IGL01945:Apbb2 APN 5 66400251 missense probably damaging 1.00
IGL03108:Apbb2 APN 5 66400231 missense probably damaging 1.00
IGL03324:Apbb2 APN 5 66312157 critical splice donor site probably null
bund UTSW 5 66400255 missense probably damaging 1.00
Dionysis UTSW 5 66452250 missense probably damaging 0.99
R0266:Apbb2 UTSW 5 66302611 missense probably benign 0.32
R0309:Apbb2 UTSW 5 66310988 splice site probably benign
R0410:Apbb2 UTSW 5 66451806 missense possibly damaging 0.88
R0882:Apbb2 UTSW 5 66400255 missense probably damaging 1.00
R1075:Apbb2 UTSW 5 66302678 missense probably damaging 1.00
R1822:Apbb2 UTSW 5 66400177 missense probably benign 0.00
R1929:Apbb2 UTSW 5 66307615 missense probably benign 0.33
R4157:Apbb2 UTSW 5 66302604 nonsense probably null
R4299:Apbb2 UTSW 5 66313378 missense probably damaging 1.00
R4627:Apbb2 UTSW 5 66400076 splice site probably null
R4780:Apbb2 UTSW 5 66362817 missense probably damaging 1.00
R4940:Apbb2 UTSW 5 66452261 missense probably null
R5002:Apbb2 UTSW 5 66313325 missense possibly damaging 0.87
R5102:Apbb2 UTSW 5 66312249 splice site probably null
R5760:Apbb2 UTSW 5 66362757 missense probably benign
R5868:Apbb2 UTSW 5 66452096 missense probably damaging 1.00
R6272:Apbb2 UTSW 5 66311072 missense probably damaging 0.97
R6280:Apbb2 UTSW 5 66364982 missense probably damaging 1.00
R6399:Apbb2 UTSW 5 66451467 critical splice donor site probably null
R7091:Apbb2 UTSW 5 66313334 missense probably damaging 1.00
R7204:Apbb2 UTSW 5 66451603 missense probably damaging 1.00
X0020:Apbb2 UTSW 5 66391799 missense probably damaging 1.00
Z1088:Apbb2 UTSW 5 66302696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCGCCTGAATATTAGTCAGTGC -3'
(R):5'- TCTCAAACATAACTGGGGAAAGCCATC -3'

Sequencing Primer
(F):5'- AGTCAGTGCATATTTTTTCCTGC -3'
(R):5'- GTGGTGATTAAAGACTCCTGACC -3'
Posted On2013-06-11