Incidental Mutation 'R0564:Tmem132d'
ID46064
Institutional Source Beutler Lab
Gene Symbol Tmem132d
Ensembl Gene ENSMUSG00000034310
Gene Nametransmembrane protein 132D
Synonyms
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R0564 (G1)
Quality Score210
Status Validated
Chromosome5
Chromosomal Location127781630-128433077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127784778 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 760 (E760K)
Ref Sequence ENSEMBL: ENSMUSP00000043633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044441]
Predicted Effect probably damaging
Transcript: ENSMUST00000044441
AA Change: E760K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043633
Gene: ENSMUSG00000034310
AA Change: E760K

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:TMEM132D_N 49 178 1.9e-59 PFAM
Pfam:TMEM132 435 778 3.9e-150 PFAM
Pfam:TMEM132D_C 884 970 1.9e-37 PFAM
low complexity region 998 1011 N/A INTRINSIC
Meta Mutation Damage Score 0.326 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Tmem132d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmem132d APN 5 127784832 missense possibly damaging 0.77
IGL01393:Tmem132d APN 5 127784638 missense probably benign 0.31
IGL01482:Tmem132d APN 5 128269206 missense probably damaging 0.96
IGL01785:Tmem132d APN 5 127984315 missense probably benign 0.00
IGL02409:Tmem132d APN 5 127784888 missense probably damaging 1.00
IGL02539:Tmem132d APN 5 127783979 missense probably benign 0.01
IGL03411:Tmem132d APN 5 127984283 nonsense probably null
R0113:Tmem132d UTSW 5 127784593 missense probably benign 0.11
R0420:Tmem132d UTSW 5 127864646 missense probably benign 0.26
R0437:Tmem132d UTSW 5 127789785 missense probably damaging 0.99
R0468:Tmem132d UTSW 5 128269203 missense probably damaging 1.00
R0659:Tmem132d UTSW 5 127984287 missense possibly damaging 0.94
R0924:Tmem132d UTSW 5 127984439 splice site probably benign
R1209:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R1333:Tmem132d UTSW 5 127784859 missense probably benign
R1378:Tmem132d UTSW 5 128268947 missense probably benign 0.43
R1741:Tmem132d UTSW 5 127784858 missense probably benign 0.30
R1753:Tmem132d UTSW 5 127789855 missense probably benign 0.02
R1944:Tmem132d UTSW 5 127783764 makesense probably null
R1974:Tmem132d UTSW 5 128269199 missense probably damaging 0.99
R2035:Tmem132d UTSW 5 127792458 missense probably damaging 1.00
R2065:Tmem132d UTSW 5 127784441 missense probably benign
R2074:Tmem132d UTSW 5 128269131 missense probably damaging 1.00
R2276:Tmem132d UTSW 5 127795923 missense probably damaging 1.00
R2297:Tmem132d UTSW 5 128268544 missense possibly damaging 0.69
R2424:Tmem132d UTSW 5 127864599 missense probably benign 0.09
R2902:Tmem132d UTSW 5 127783768 missense probably benign
R3053:Tmem132d UTSW 5 127792474 missense probably benign 0.15
R3836:Tmem132d UTSW 5 127784885 missense probably damaging 1.00
R4127:Tmem132d UTSW 5 128268820 missense probably benign 0.35
R4236:Tmem132d UTSW 5 128432325 missense possibly damaging 0.89
R4358:Tmem132d UTSW 5 127984341 missense possibly damaging 0.92
R4610:Tmem132d UTSW 5 127984296 missense probably benign 0.29
R4686:Tmem132d UTSW 5 127792610 missense possibly damaging 0.55
R4814:Tmem132d UTSW 5 127984264 missense probably benign 0.01
R4883:Tmem132d UTSW 5 128269300 missense probably damaging 0.99
R4883:Tmem132d UTSW 5 128269302 missense possibly damaging 0.79
R4939:Tmem132d UTSW 5 127796075 missense probably damaging 1.00
R5579:Tmem132d UTSW 5 127796000 missense possibly damaging 0.67
R5652:Tmem132d UTSW 5 127784795 missense possibly damaging 0.88
R5801:Tmem132d UTSW 5 127784900 missense possibly damaging 0.50
R5900:Tmem132d UTSW 5 128269272 missense probably damaging 1.00
R5980:Tmem132d UTSW 5 127784598 missense probably benign 0.13
R6048:Tmem132d UTSW 5 128269117 missense probably benign 0.03
R6057:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R6084:Tmem132d UTSW 5 127784100 missense probably benign 0.06
R6505:Tmem132d UTSW 5 127784438 missense probably benign 0.00
R6522:Tmem132d UTSW 5 127783768 missense probably benign
R6540:Tmem132d UTSW 5 128268532 missense possibly damaging 0.87
R6717:Tmem132d UTSW 5 127784421 missense probably benign
R7158:Tmem132d UTSW 5 128137019 missense possibly damaging 0.81
R7287:Tmem132d UTSW 5 127984351 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTGTCCACTCTCACTGCTGTTG -3'
(R):5'- TGGTAAAGCATCTCGTGGCTTTCTC -3'

Sequencing Primer
(F):5'- GGGGTTTGCATCATTCTGTCC -3'
(R):5'- cacagacagagacagagacag -3'
Posted On2013-06-11