Incidental Mutation 'R5906:Olfr145'
ID460643
Institutional Source Beutler Lab
Gene Symbol Olfr145
Ensembl Gene ENSMUSG00000066748
Gene Nameolfactory receptor 145
SynonymsK21, MOR161-6, GA_x6K02T2PVTD-31578734-31579666
MMRRC Submission 044103-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5906 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37896724-37903519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37897878 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 158 (H158R)
Ref Sequence ENSEMBL: ENSMUSP00000150284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086062] [ENSMUST00000213688]
Predicted Effect probably damaging
Transcript: ENSMUST00000086062
AA Change: H158R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083229
Gene: ENSMUSG00000066748
AA Change: H158R

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-51 PFAM
Pfam:7tm_1 40 289 1.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213688
AA Change: H158R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
9130023H24Rik G A 7: 128,236,492 P310S probably benign Het
Abcc10 G T 17: 46,316,559 H652Q probably benign Het
Actl6b A G 5: 137,567,329 I396V possibly damaging Het
Acvr1b T C 15: 101,193,891 probably benign Het
Adamts18 A T 8: 113,709,619 H989Q probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Angptl3 A G 4: 99,037,567 T377A probably benign Het
Ankmy2 G A 12: 36,176,633 V109M probably damaging Het
Anpep G A 7: 79,833,675 A689V probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cacna1d C T 14: 30,096,960 V1213I probably damaging Het
Capn1 A G 19: 6,011,421 F156L possibly damaging Het
Catsperb C A 12: 101,510,462 F408L probably damaging Het
Ccdc146 A T 5: 21,301,352 L697Q possibly damaging Het
Cd163l1 T A 7: 140,228,799 D874E probably damaging Het
Cdc37l1 T A 19: 29,011,986 V281E probably benign Het
Chia1 A T 3: 106,131,988 T465S probably benign Het
Cidec A T 6: 113,428,321 probably null Het
Clcnkb T C 4: 141,412,299 T131A probably benign Het
Clec5a T A 6: 40,581,859 M98L probably benign Het
Cnga1 A T 5: 72,610,858 F162I probably benign Het
Cyp27b1 A T 10: 127,048,398 I40F probably damaging Het
Edrf1 A G 7: 133,663,415 S1027G probably benign Het
Entpd1 C A 19: 40,738,839 A448E probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Etfdh T C 3: 79,604,115 I520V probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gabra4 G A 5: 71,623,910 P386L probably benign Het
Gckr G T 5: 31,306,578 V281L probably damaging Het
Gfy T C 7: 45,177,743 T310A probably benign Het
Gjc2 C A 11: 59,176,841 V272L probably benign Het
Gm13441 G C 2: 31,887,499 silent Het
H2-DMb2 T A 17: 34,148,608 M1K probably null Het
Hipk3 T C 2: 104,471,808 Y13C probably damaging Het
Kcnt1 A T 2: 25,894,524 probably benign Het
Kcnt1 T C 2: 25,898,401 F336S probably damaging Het
Klhdc7b A G 15: 89,387,156 D747G probably benign Het
Krt78 T A 15: 101,948,595 E359V probably damaging Het
Mast4 T C 13: 102,735,744 D2195G probably benign Het
Matk C T 10: 81,260,919 L188F probably damaging Het
Mcoln2 T C 3: 146,183,741 I399T probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nap1l1 A T 10: 111,491,030 K151* probably null Het
Ncbp3 T A 11: 73,073,501 S426T probably benign Het
Nisch T A 14: 31,172,028 probably null Het
Olfr1467 T C 19: 13,365,005 C126R probably damaging Het
Olfr160 A G 9: 37,711,805 I158T probably benign Het
Olfr725 T C 14: 50,034,849 T185A probably benign Het
Peg3 T C 7: 6,717,855 D17G probably damaging Het
Pkd1 G A 17: 24,572,920 V1194M probably benign Het
Pkd1l2 A T 8: 117,029,648 I1615N probably damaging Het
Pkd2 A T 5: 104,477,179 probably null Het
Pkp4 T A 2: 59,305,076 N97K possibly damaging Het
Prrx2 C T 2: 30,879,510 R78C probably damaging Het
Pycr1 T A 11: 120,642,162 I91F probably damaging Het
Rap1a T C 3: 105,737,765 N87S possibly damaging Het
Sbk2 T G 7: 4,957,628 Y181S probably damaging Het
Sec16a A T 2: 26,438,831 H1057Q possibly damaging Het
Sfswap G A 5: 129,542,043 E486K probably benign Het
Shank3 T C 15: 89,548,916 V1213A probably damaging Het
Slfn5 T A 11: 82,957,276 I329K probably benign Het
Slit1 T A 19: 41,606,374 N1186Y probably damaging Het
Ssbp3 A G 4: 107,009,821 probably benign Het
Steap3 T A 1: 120,244,001 I125F probably damaging Het
Synpr C A 14: 13,608,788 probably benign Het
Tom1 T C 8: 75,050,258 L69P probably damaging Het
Traf3ip3 T A 1: 193,198,006 D5V possibly damaging Het
Vmn1r29 G A 6: 58,307,751 S152N probably benign Het
Vmn1r68 T C 7: 10,527,623 I183V probably benign Het
Wdr17 C G 8: 54,639,468 V1094L probably benign Het
Wdr95 A G 5: 149,564,227 I109V possibly damaging Het
Zfp39 T C 11: 58,902,891 D7G probably benign Het
Zfp512 A T 5: 31,480,064 Q443L probably damaging Het
Zfp974 T A 7: 27,910,805 K498N possibly damaging Het
Other mutations in Olfr145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Olfr145 APN 9 37898063 missense probably benign 0.13
IGL01586:Olfr145 APN 9 37897976 missense possibly damaging 0.73
IGL02185:Olfr145 APN 9 37898235 missense probably damaging 1.00
IGL02895:Olfr145 APN 9 37897982 missense probably benign 0.01
IGL02956:Olfr145 APN 9 37898108 missense probably damaging 1.00
R0391:Olfr145 UTSW 9 37897842 missense probably benign 0.31
R0513:Olfr145 UTSW 9 37898055 missense probably damaging 1.00
R4600:Olfr145 UTSW 9 37898326 missense probably benign
R4610:Olfr145 UTSW 9 37898326 missense probably benign
R4611:Olfr145 UTSW 9 37898326 missense probably benign
R4982:Olfr145 UTSW 9 37897515 missense probably damaging 1.00
R5574:Olfr145 UTSW 9 37897581 missense probably damaging 1.00
R5608:Olfr145 UTSW 9 37897782 missense probably damaging 0.98
R5688:Olfr145 UTSW 9 37898063 missense possibly damaging 0.91
R6286:Olfr145 UTSW 9 37897778 missense probably damaging 0.99
R7138:Olfr145 UTSW 9 37898064 missense probably damaging 0.99
R7145:Olfr145 UTSW 9 37897563 missense probably benign 0.01
X0012:Olfr145 UTSW 9 37898328 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACTCTGGATGCATGACCCAG -3'
(R):5'- CTCTGTGGAACTGATGCGAAG -3'

Sequencing Primer
(F):5'- GGATGCATGACCCAGCTCTTC -3'
(R):5'- TCTGTGGAACTGATGCGAAGGATAC -3'
Posted On2017-02-28