Mutagenetix > Incidental Mutation

Incidental Mutation 'R5906:Mast4'

460654

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

044103-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.304) question?

Stock #

R5906 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102868994-103471005 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102872252 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2195 (D2195G)

Ref Sequence

ENSEMBL: ENSMUSP00000096808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]

AlphaFold

Q811L6

Predicted Effect

probably benign
Transcript: ENSMUST00000099202
AA Change: D2195G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: D2195G

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167058
AA Change: D2372G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: D2372G

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000171791
AA Change: D2180G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: D2180G

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: D2204G

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.4%
20x: 92.4%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	C	A	11: 58,182,260 (GRCm39)		probably null	Het
9130023H24Rik	G	A	7: 127,835,664 (GRCm39)	P310S	probably benign	Het
Abcc10	G	T	17: 46,627,485 (GRCm39)	H652Q	probably benign	Het
Actl6b	A	G	5: 137,565,591 (GRCm39)	I396V	possibly damaging	Het
Acvr1b	T	C	15: 101,091,772 (GRCm39)		probably benign	Het
Adamts18	A	T	8: 114,436,251 (GRCm39)	H989Q	probably benign	Het
Adamtsl4	T	C	3: 95,588,094 (GRCm39)	Y631C	probably damaging	Het
Angptl3	A	G	4: 98,925,804 (GRCm39)	T377A	probably benign	Het
Ankmy2	G	A	12: 36,226,632 (GRCm39)	V109M	probably damaging	Het
Anpep	G	A	7: 79,483,423 (GRCm39)	A689V	probably benign	Het
Brwd1	A	T	16: 95,859,938 (GRCm39)	M350K	probably damaging	Het
Cacna1d	C	T	14: 29,818,917 (GRCm39)	V1213I	probably damaging	Het
Capn1	A	G	19: 6,061,451 (GRCm39)	F156L	possibly damaging	Het
Catsperb	C	A	12: 101,476,721 (GRCm39)	F408L	probably damaging	Het
Ccdc146	A	T	5: 21,506,350 (GRCm39)	L697Q	possibly damaging	Het
Cdc37l1	T	A	19: 28,989,386 (GRCm39)	V281E	probably benign	Het
Chia1	A	T	3: 106,039,304 (GRCm39)	T465S	probably benign	Het
Cidec	A	T	6: 113,405,282 (GRCm39)		probably null	Het
Clcnkb	T	C	4: 141,139,610 (GRCm39)	T131A	probably benign	Het
Clec5a	T	A	6: 40,558,793 (GRCm39)	M98L	probably benign	Het
Cnga1	A	T	5: 72,768,201 (GRCm39)	F162I	probably benign	Het
Cyp27b1	A	T	10: 126,884,267 (GRCm39)	I40F	probably damaging	Het
Edrf1	A	G	7: 133,265,144 (GRCm39)	S1027G	probably benign	Het
Entpd1	C	A	19: 40,727,283 (GRCm39)	A448E	probably damaging	Het
Espl1	T	C	15: 102,205,286 (GRCm39)		probably null	Het
Etfdh	T	C	3: 79,511,422 (GRCm39)	I520V	probably damaging	Het
Fchsd1	C	T	18: 38,092,926 (GRCm39)		probably benign	Het
Gabra4	G	A	5: 71,781,253 (GRCm39)	P386L	probably benign	Het
Gckr	G	T	5: 31,463,922 (GRCm39)	V281L	probably damaging	Het
Gfy	T	C	7: 44,827,167 (GRCm39)	T310A	probably benign	Het
Gjc2	C	A	11: 59,067,667 (GRCm39)	V272L	probably benign	Het
Gm13441	G	C	2: 31,777,511 (GRCm39)		silent	Het
H2-DMb2	T	A	17: 34,367,582 (GRCm39)	M1K	probably null	Het
Hipk3	T	C	2: 104,302,153 (GRCm39)	Y13C	probably damaging	Het
Kcnt1	A	T	2: 25,784,536 (GRCm39)		probably benign	Het
Kcnt1	T	C	2: 25,788,413 (GRCm39)	F336S	probably damaging	Het
Klhdc7b	A	G	15: 89,271,359 (GRCm39)	D747G	probably benign	Het
Krt78	T	A	15: 101,857,030 (GRCm39)	E359V	probably damaging	Het
Matk	C	T	10: 81,096,753 (GRCm39)	L188F	probably damaging	Het
Mcoln2	T	C	3: 145,889,496 (GRCm39)	I399T	probably damaging	Het
Mroh2a	A	G	1: 88,186,386 (GRCm39)	S64G	probably benign	Het
Nap1l1	A	T	10: 111,326,891 (GRCm39)	K151*	probably null	Het
Ncbp3	T	A	11: 72,964,327 (GRCm39)	S426T	probably benign	Het
Nisch	T	A	14: 30,893,985 (GRCm39)		probably null	Het
Or4k15b	T	C	14: 50,272,306 (GRCm39)	T185A	probably benign	Het
Or5b113	T	C	19: 13,342,369 (GRCm39)	C126R	probably damaging	Het
Or8a1b	A	G	9: 37,623,101 (GRCm39)	I158T	probably benign	Het
Or8b8	A	G	9: 37,809,174 (GRCm39)	H158R	probably damaging	Het
Peg3	T	C	7: 6,720,854 (GRCm39)	D17G	probably damaging	Het
Pkd1	G	A	17: 24,791,894 (GRCm39)	V1194M	probably benign	Het
Pkd1l2	A	T	8: 117,756,387 (GRCm39)	I1615N	probably damaging	Het
Pkd2	A	T	5: 104,625,045 (GRCm39)		probably null	Het
Pkp4	T	A	2: 59,135,420 (GRCm39)	N97K	possibly damaging	Het
Prrx2	C	T	2: 30,769,522 (GRCm39)	R78C	probably damaging	Het
Pycr1	T	A	11: 120,532,988 (GRCm39)	I91F	probably damaging	Het
Rap1a	T	C	3: 105,645,081 (GRCm39)	N87S	possibly damaging	Het
Sbk2	T	G	7: 4,960,627 (GRCm39)	Y181S	probably damaging	Het
Scart1	T	A	7: 139,808,712 (GRCm39)	D874E	probably damaging	Het
Sec16a	A	T	2: 26,328,843 (GRCm39)	H1057Q	possibly damaging	Het
Sfswap	G	A	5: 129,619,107 (GRCm39)	E486K	probably benign	Het
Shank3	T	C	15: 89,433,119 (GRCm39)	V1213A	probably damaging	Het
Slfn5	T	A	11: 82,848,102 (GRCm39)	I329K	probably benign	Het
Slit1	T	A	19: 41,594,813 (GRCm39)	N1186Y	probably damaging	Het
Ssbp3	A	G	4: 106,867,018 (GRCm39)		probably benign	Het
Steap3	T	A	1: 120,171,731 (GRCm39)	I125F	probably damaging	Het
Synpr	C	A	14: 13,608,788 (GRCm38)		probably benign	Het
Tom1	T	C	8: 75,776,886 (GRCm39)	L69P	probably damaging	Het
Traf3ip3	T	A	1: 192,880,314 (GRCm39)	D5V	possibly damaging	Het
Vmn1r29	G	A	6: 58,284,736 (GRCm39)	S152N	probably benign	Het
Vmn1r68	T	C	7: 10,261,550 (GRCm39)	I183V	probably benign	Het
Wdr17	C	G	8: 55,092,503 (GRCm39)	V1094L	probably benign	Het
Wdr95	A	G	5: 149,487,692 (GRCm39)	I109V	possibly damaging	Het
Zfp39	T	C	11: 58,793,717 (GRCm39)	D7G	probably benign	Het
Zfp512	A	T	5: 31,637,408 (GRCm39)	Q443L	probably damaging	Het
Zfp974	T	A	7: 27,610,230 (GRCm39)	K498N	possibly damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102,907,275 (GRCm39)	nonsense	probably null
IGL00933:Mast4	APN	13	102,871,874 (GRCm39)	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102,910,744 (GRCm39)	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102,890,576 (GRCm39)	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102,897,523 (GRCm39)	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102,904,401 (GRCm39)	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102,887,020 (GRCm39)	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102,874,123 (GRCm39)	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102,873,749 (GRCm39)	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102,910,781 (GRCm39)	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102,874,482 (GRCm39)	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102,878,545 (GRCm39)	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102,872,004 (GRCm39)	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102,990,331 (GRCm39)	makesense	probably null
IGL02850:Mast4	APN	13	102,890,740 (GRCm39)	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102,872,184 (GRCm39)	missense	probably benign
IGL03064:Mast4	APN	13	102,897,472 (GRCm39)	nonsense	probably null
IGL03124:Mast4	APN	13	102,874,753 (GRCm39)	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102,874,163 (GRCm39)	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102,890,764 (GRCm39)	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102,887,905 (GRCm39)	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102,873,615 (GRCm39)	missense	possibly damaging	0.46
buck	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
doe	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
skinnybones	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102,871,370 (GRCm39)	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102,872,825 (GRCm39)	small insertion	probably benign
FR4340:Mast4	UTSW	13	102,871,365 (GRCm39)	frame shift	probably null
FR4548:Mast4	UTSW	13	102,872,826 (GRCm39)	small insertion	probably benign
FR4976:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
FR4976:Mast4	UTSW	13	102,872,820 (GRCm39)	small insertion	probably benign
NA:Mast4	UTSW	13	102,878,565 (GRCm39)	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102,878,566 (GRCm39)	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103,470,723 (GRCm39)	start gained	probably benign
R0242:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102,890,669 (GRCm39)	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102,871,781 (GRCm39)	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102,888,068 (GRCm39)	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102,895,252 (GRCm39)	splice site	probably benign
R0744:Mast4	UTSW	13	102,873,895 (GRCm39)	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102,990,408 (GRCm39)	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102,907,292 (GRCm39)	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102,872,004 (GRCm39)	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102,887,086 (GRCm39)	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102,909,027 (GRCm39)	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102,873,431 (GRCm39)	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102,875,771 (GRCm39)	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102,930,625 (GRCm39)	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102,887,917 (GRCm39)	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102,875,354 (GRCm39)	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102,895,601 (GRCm39)	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102,887,054 (GRCm39)	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102,890,713 (GRCm39)	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102,871,983 (GRCm39)	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102,872,259 (GRCm39)	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102,934,715 (GRCm39)	splice site	probably benign
R2370:Mast4	UTSW	13	102,910,695 (GRCm39)	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102,875,147 (GRCm39)	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102,872,939 (GRCm39)	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102,990,434 (GRCm39)	splice site	probably benign
R3434:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102,923,927 (GRCm39)	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4021:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4022:Mast4	UTSW	13	102,990,377 (GRCm39)	missense	probably damaging	1.00
R4022:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4210:Mast4	UTSW	13	102,875,713 (GRCm39)	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102,910,756 (GRCm39)	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102,873,766 (GRCm39)	nonsense	probably null
R4627:Mast4	UTSW	13	103,470,529 (GRCm39)	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103,470,627 (GRCm39)	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102,910,692 (GRCm39)	critical splice donor site	probably null
R4995:Mast4	UTSW	13	103,042,262 (GRCm39)	intron	probably benign
R5059:Mast4	UTSW	13	102,887,071 (GRCm39)	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102,875,391 (GRCm39)	nonsense	probably null
R5101:Mast4	UTSW	13	102,872,864 (GRCm39)	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102,890,723 (GRCm39)	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102,873,987 (GRCm39)	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102,930,580 (GRCm39)	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102,910,701 (GRCm39)	nonsense	probably null
R5908:Mast4	UTSW	13	102,874,764 (GRCm39)	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102,872,148 (GRCm39)	missense	probably benign
R5987:Mast4	UTSW	13	102,895,242 (GRCm39)	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102,990,391 (GRCm39)	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102,872,717 (GRCm39)	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102,897,890 (GRCm39)	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102,872,493 (GRCm39)	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102,874,004 (GRCm39)	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102,941,222 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,934,586 (GRCm39)	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102,872,482 (GRCm39)	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102,874,223 (GRCm39)	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103,470,508 (GRCm39)	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102,874,986 (GRCm39)	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102,930,511 (GRCm39)	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102,887,932 (GRCm39)	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102,923,934 (GRCm39)	nonsense	probably null
R7697:Mast4	UTSW	13	102,875,711 (GRCm39)	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102,890,596 (GRCm39)	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102,875,783 (GRCm39)	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102,874,184 (GRCm39)	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	103,089,633 (GRCm39)	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102,872,247 (GRCm39)	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102,875,229 (GRCm39)	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102,887,986 (GRCm39)	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102,897,900 (GRCm39)	missense	probably damaging	1.00
R8796:Mast4	UTSW	13	102,919,899 (GRCm39)	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102,895,174 (GRCm39)	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102,934,606 (GRCm39)	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.99
R9389:Mast4	UTSW	13	103,470,438 (GRCm39)	missense	probably benign	0.00
R9404:Mast4	UTSW	13	102,887,933 (GRCm39)	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102,925,532 (GRCm39)	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102,872,944 (GRCm39)	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102,873,593 (GRCm39)	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102,910,711 (GRCm39)	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF015:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
RF019:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF037:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF039:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF040:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
Z1088:Mast4	UTSW	13	102,875,027 (GRCm39)	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102,874,968 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGTTTCAGCCAGTGACTTC -3'
(R):5'- GTGTCCTCTCGATGCCAAAC -3'

Sequencing Primer
(F):5'- TCTCTGAGCCTCTGAGTC -3'
(R):5'- GGACATCTCAGTGAAGCAGC -3'

Posted On

2017-02-28