Incidental Mutation 'R0564:Nlrp4b'
ID46066
Institutional Source Beutler Lab
Gene Symbol Nlrp4b
Ensembl Gene ENSMUSG00000034087
Gene NameNLR family, pyrin domain containing 4B
SynonymsNalp4b, Nalp-gamma
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10687789-10730168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10714658 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 263 (I263V)
Ref Sequence ENSEMBL: ENSMUSP00000113095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047809] [ENSMUST00000117413] [ENSMUST00000132990] [ENSMUST00000211069]
Predicted Effect probably benign
Transcript: ENSMUST00000047809
AA Change: I263V

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043881
Gene: ENSMUSG00000034087
AA Change: I263V

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 7.9e-40 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117413
AA Change: I263V

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113095
Gene: ENSMUSG00000034087
AA Change: I263V

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 3.3e-39 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132990
SMART Domains Protein: ENSMUSP00000115831
Gene: ENSMUSG00000034087

DomainStartEndE-ValueType
low complexity region 153 168 N/A INTRINSIC
LRR 316 343 4.9e0 SMART
LRR 345 372 1.97e0 SMART
LRR 373 400 1.13e-4 SMART
LRR 402 429 1.93e1 SMART
LRR 430 457 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211069
Predicted Effect probably benign
Transcript: ENSMUST00000211258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211772
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Nlrp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Nlrp4b APN 7 10714955 missense possibly damaging 0.68
IGL01456:Nlrp4b APN 7 10714223 missense probably benign 0.26
IGL01537:Nlrp4b APN 7 10714991 missense probably damaging 1.00
IGL02539:Nlrp4b APN 7 10714428 missense probably damaging 0.96
IGL02730:Nlrp4b APN 7 10714758 missense probably damaging 1.00
IGL02871:Nlrp4b APN 7 10715265 missense probably benign 0.26
IGL03008:Nlrp4b APN 7 10714589 missense probably benign 0.00
IGL03109:Nlrp4b APN 7 10714946 missense probably damaging 1.00
IGL03251:Nlrp4b APN 7 10714500 missense probably benign 0.01
IGL03354:Nlrp4b APN 7 10714538 missense probably damaging 0.99
R0052:Nlrp4b UTSW 7 10725962 nonsense probably null
R0348:Nlrp4b UTSW 7 10715181 missense possibly damaging 0.60
R0573:Nlrp4b UTSW 7 10714215 missense probably benign 0.01
R0581:Nlrp4b UTSW 7 10714530 missense probably damaging 1.00
R1201:Nlrp4b UTSW 7 10715436 missense possibly damaging 0.64
R1541:Nlrp4b UTSW 7 10725052 missense possibly damaging 0.91
R1771:Nlrp4b UTSW 7 10718593 missense probably damaging 0.96
R1781:Nlrp4b UTSW 7 10715339 missense probably benign 0.13
R1833:Nlrp4b UTSW 7 10725936 missense probably benign 0.00
R2405:Nlrp4b UTSW 7 10714728 missense probably benign 0.08
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2873:Nlrp4b UTSW 7 10710243 nonsense probably null
R2904:Nlrp4b UTSW 7 10714367 missense probably damaging 1.00
R3410:Nlrp4b UTSW 7 10715529 missense probably damaging 1.00
R3714:Nlrp4b UTSW 7 10714881 missense probably benign 0.04
R3982:Nlrp4b UTSW 7 10714431 missense possibly damaging 0.95
R4668:Nlrp4b UTSW 7 10714733 missense possibly damaging 0.66
R4690:Nlrp4b UTSW 7 10719203 missense probably benign 0.00
R4857:Nlrp4b UTSW 7 10715298 missense probably benign 0.05
R5247:Nlrp4b UTSW 7 10714218 missense probably benign 0.21
R5381:Nlrp4b UTSW 7 10715245 nonsense probably null
R5529:Nlrp4b UTSW 7 10714946 missense possibly damaging 0.91
R5589:Nlrp4b UTSW 7 10715585 missense probably benign 0.34
R5770:Nlrp4b UTSW 7 10715487 missense probably benign 0.00
R5990:Nlrp4b UTSW 7 10714491 missense possibly damaging 0.61
R6049:Nlrp4b UTSW 7 10714713 nonsense probably null
R6329:Nlrp4b UTSW 7 10724920 missense probably benign 0.16
R6377:Nlrp4b UTSW 7 10715412 missense probably benign 0.00
R7107:Nlrp4b UTSW 7 10715217 missense probably damaging 0.96
R7209:Nlrp4b UTSW 7 10710370 missense probably benign 0.01
R7237:Nlrp4b UTSW 7 10715216 missense probably benign 0.12
X0063:Nlrp4b UTSW 7 10729587 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTGATCTGATCTCCAGAGAGTG -3'
(R):5'- ACAGGGGCCTGACATACAGTGAAC -3'

Sequencing Primer
(F):5'- ATCTCCAGAGAGTGGCCTAGC -3'
(R):5'- CATTTTCTCTTATCAAACTGAAGGC -3'
Posted On2013-06-11