Incidental Mutation 'R5906:Espl1'
ID460662
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 044103-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5906 (G1)
Quality Score158
Status Validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 102296851 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]
Predicted Effect probably null
Transcript: ENSMUST00000064924
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000229050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229580
Predicted Effect probably null
Transcript: ENSMUST00000230212
Predicted Effect probably null
Transcript: ENSMUST00000231104
Meta Mutation Damage Score 0.514 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
9130023H24Rik G A 7: 128,236,492 P310S probably benign Het
Abcc10 G T 17: 46,316,559 H652Q probably benign Het
Actl6b A G 5: 137,567,329 I396V possibly damaging Het
Acvr1b T C 15: 101,193,891 probably benign Het
Adamts18 A T 8: 113,709,619 H989Q probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Angptl3 A G 4: 99,037,567 T377A probably benign Het
Ankmy2 G A 12: 36,176,633 V109M probably damaging Het
Anpep G A 7: 79,833,675 A689V probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cacna1d C T 14: 30,096,960 V1213I probably damaging Het
Capn1 A G 19: 6,011,421 F156L possibly damaging Het
Catsperb C A 12: 101,510,462 F408L probably damaging Het
Ccdc146 A T 5: 21,301,352 L697Q possibly damaging Het
Cd163l1 T A 7: 140,228,799 D874E probably damaging Het
Cdc37l1 T A 19: 29,011,986 V281E probably benign Het
Chia1 A T 3: 106,131,988 T465S probably benign Het
Cidec A T 6: 113,428,321 probably null Het
Clcnkb T C 4: 141,412,299 T131A probably benign Het
Clec5a T A 6: 40,581,859 M98L probably benign Het
Cnga1 A T 5: 72,610,858 F162I probably benign Het
Cyp27b1 A T 10: 127,048,398 I40F probably damaging Het
Edrf1 A G 7: 133,663,415 S1027G probably benign Het
Entpd1 C A 19: 40,738,839 A448E probably damaging Het
Etfdh T C 3: 79,604,115 I520V probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gabra4 G A 5: 71,623,910 P386L probably benign Het
Gckr G T 5: 31,306,578 V281L probably damaging Het
Gfy T C 7: 45,177,743 T310A probably benign Het
Gjc2 C A 11: 59,176,841 V272L probably benign Het
Gm13441 G C 2: 31,887,499 silent Het
H2-DMb2 T A 17: 34,148,608 M1K probably null Het
Hipk3 T C 2: 104,471,808 Y13C probably damaging Het
Kcnt1 A T 2: 25,894,524 probably benign Het
Kcnt1 T C 2: 25,898,401 F336S probably damaging Het
Klhdc7b A G 15: 89,387,156 D747G probably benign Het
Krt78 T A 15: 101,948,595 E359V probably damaging Het
Mast4 T C 13: 102,735,744 D2195G probably benign Het
Matk C T 10: 81,260,919 L188F probably damaging Het
Mcoln2 T C 3: 146,183,741 I399T probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nap1l1 A T 10: 111,491,030 K151* probably null Het
Ncbp3 T A 11: 73,073,501 S426T probably benign Het
Nisch T A 14: 31,172,028 probably null Het
Olfr145 A G 9: 37,897,878 H158R probably damaging Het
Olfr1467 T C 19: 13,365,005 C126R probably damaging Het
Olfr160 A G 9: 37,711,805 I158T probably benign Het
Olfr725 T C 14: 50,034,849 T185A probably benign Het
Peg3 T C 7: 6,717,855 D17G probably damaging Het
Pkd1 G A 17: 24,572,920 V1194M probably benign Het
Pkd1l2 A T 8: 117,029,648 I1615N probably damaging Het
Pkd2 A T 5: 104,477,179 probably null Het
Pkp4 T A 2: 59,305,076 N97K possibly damaging Het
Prrx2 C T 2: 30,879,510 R78C probably damaging Het
Pycr1 T A 11: 120,642,162 I91F probably damaging Het
Rap1a T C 3: 105,737,765 N87S possibly damaging Het
Sbk2 T G 7: 4,957,628 Y181S probably damaging Het
Sec16a A T 2: 26,438,831 H1057Q possibly damaging Het
Sfswap G A 5: 129,542,043 E486K probably benign Het
Shank3 T C 15: 89,548,916 V1213A probably damaging Het
Slfn5 T A 11: 82,957,276 I329K probably benign Het
Slit1 T A 19: 41,606,374 N1186Y probably damaging Het
Ssbp3 A G 4: 107,009,821 probably benign Het
Steap3 T A 1: 120,244,001 I125F probably damaging Het
Synpr C A 14: 13,608,788 probably benign Het
Tom1 T C 8: 75,050,258 L69P probably damaging Het
Traf3ip3 T A 1: 193,198,006 D5V possibly damaging Het
Vmn1r29 G A 6: 58,307,751 S152N probably benign Het
Vmn1r68 T C 7: 10,527,623 I183V probably benign Het
Wdr17 C G 8: 54,639,468 V1094L probably benign Het
Wdr95 A G 5: 149,564,227 I109V possibly damaging Het
Zfp39 T C 11: 58,902,891 D7G probably benign Het
Zfp512 A T 5: 31,480,064 Q443L probably damaging Het
Zfp974 T A 7: 27,910,805 K498N possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCGCATAGGATTTCTGG -3'
(R):5'- ATGATCACATTAGTAGCCCTAGGG -3'

Sequencing Primer
(F):5'- CGCATAGGATTTCTGGTGGGATTC -3'
(R):5'- GGCTGGCTTCGAACTCAGAAATTC -3'
Posted On2017-02-28