Incidental Mutation 'R0564:Olfr551'
ID46068
Institutional Source Beutler Lab
Gene Symbol Olfr551
Ensembl Gene ENSMUSG00000073974
Gene Nameolfactory receptor 551
SynonymsMOR29-1, GA_x6K02T2PBJ9-5307445-5306498
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102583510-102591886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102588531 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 71 (I71V)
Ref Sequence ENSEMBL: ENSMUSP00000150582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098224] [ENSMUST00000213540]
Predicted Effect probably benign
Transcript: ENSMUST00000098224
AA Change: I71V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095827
Gene: ENSMUSG00000073974
AA Change: I71V

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.8e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 152 2e-9 PFAM
Pfam:7tm_1 43 293 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213540
AA Change: I71V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Olfr551
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Olfr551 APN 7 102588229 nonsense probably null
IGL03034:Olfr551 APN 7 102587940 missense probably benign 0.42
IGL03076:Olfr551 APN 7 102588472 missense probably benign
R0890:Olfr551 UTSW 7 102588201 nonsense probably null
R0909:Olfr551 UTSW 7 102588447 missense probably damaging 1.00
R1053:Olfr551 UTSW 7 102587959 nonsense probably null
R4708:Olfr551 UTSW 7 102587836 missense probably benign 0.00
R4932:Olfr551 UTSW 7 102588416 missense probably damaging 0.98
R6248:Olfr551 UTSW 7 102588030 missense probably benign 0.00
R6343:Olfr551 UTSW 7 102588546 missense probably damaging 0.98
R6389:Olfr551 UTSW 7 102588472 missense probably benign
R6455:Olfr551 UTSW 7 102588671 missense probably benign 0.00
R7305:Olfr551 UTSW 7 102587955 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACAGACTCTGAGGACAGCAATGAC -3'
(R):5'- TCGGCCTGATCATGCAACACAC -3'

Sequencing Primer
(F):5'- CAATGACCCGTAGTGCAATG -3'
(R):5'- GAACCCAAGCTCCTTCCTG -3'
Posted On2013-06-11