Incidental Mutation 'R0564:Cdc16'
ID46069
Institutional Source Beutler Lab
Gene Symbol Cdc16
Ensembl Gene ENSMUSG00000038416
Gene NameCDC16 cell division cycle 16
Synonyms2810431D22Rik, 2700071J12Rik
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.981) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13757676-13781938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13781618 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 617 (D617V)
Ref Sequence ENSEMBL: ENSMUSP00000047950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043767] [ENSMUST00000043962]
Predicted Effect probably benign
Transcript: ENSMUST00000043767
SMART Domains Protein: ENSMUSP00000037354
Gene: ENSMUSG00000038398

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:Smg4_UPF3 63 224 1.4e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043962
AA Change: D617V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047950
Gene: ENSMUSG00000038416
AA Change: D617V

DomainStartEndE-ValueType
Pfam:TPR_9 11 63 1.8e-3 PFAM
Pfam:ANAPC3 15 95 3.5e-23 PFAM
TPR 130 163 1.17e1 SMART
Blast:TPR 299 333 2e-8 BLAST
Blast:TPR 334 367 1e-14 BLAST
TPR 368 401 1.48e1 SMART
Blast:TPR 402 435 7e-15 BLAST
TPR 445 478 6.68e-6 SMART
TPR 479 512 1.74e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211724
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Cdc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cdc16 APN 8 13767575 nonsense probably null
IGL01109:Cdc16 APN 8 13764606 missense probably benign 0.00
IGL01475:Cdc16 APN 8 13781542 missense probably benign
IGL02729:Cdc16 APN 8 13779250 missense possibly damaging 0.93
IGL03389:Cdc16 APN 8 13759179 missense probably damaging 1.00
R0026:Cdc16 UTSW 8 13759130 splice site probably null
R0373:Cdc16 UTSW 8 13779264 missense probably benign 0.04
R0520:Cdc16 UTSW 8 13760569 critical splice donor site probably null
R1470:Cdc16 UTSW 8 13758992 splice site probably benign
R1487:Cdc16 UTSW 8 13771445 missense probably benign 0.17
R1753:Cdc16 UTSW 8 13764688 nonsense probably null
R1883:Cdc16 UTSW 8 13775738 missense probably damaging 1.00
R3087:Cdc16 UTSW 8 13759004 missense probably damaging 0.98
R3418:Cdc16 UTSW 8 13769489 nonsense probably null
R3756:Cdc16 UTSW 8 13777609 critical splice donor site probably null
R4152:Cdc16 UTSW 8 13762857 missense probably damaging 1.00
R4842:Cdc16 UTSW 8 13781644 utr 3 prime probably benign
R5122:Cdc16 UTSW 8 13764570 missense probably damaging 1.00
R5492:Cdc16 UTSW 8 13763915 splice site probably null
R5982:Cdc16 UTSW 8 13781399 missense possibly damaging 0.73
R6145:Cdc16 UTSW 8 13767573 missense possibly damaging 0.96
R6154:Cdc16 UTSW 8 13768609 missense possibly damaging 0.87
R6611:Cdc16 UTSW 8 13781512 missense probably benign
R6992:Cdc16 UTSW 8 13759188 missense probably benign 0.22
R7011:Cdc16 UTSW 8 13769451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCCCTGTGACCAGTGTTTATG -3'
(R):5'- AAAATCGGAAAACATCTGTTGCCAAGG -3'

Sequencing Primer
(F):5'- AAAGTGCTATGACTTCGATGTGC -3'
(R):5'- TGCTGTCCCACTGTTACTG -3'
Posted On2013-06-11