Incidental Mutation 'R0564:Upf3a'
ID46070
Institutional Source Beutler Lab
Gene Symbol Upf3a
Ensembl Gene ENSMUSG00000038398
Gene NameUPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms2600001C03Rik, RENT3A, 4930546M19Rik, UPF3
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13785615-13799193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13795656 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 252 (K252E)
Ref Sequence ENSEMBL: ENSMUSP00000037354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043767]
Predicted Effect probably benign
Transcript: ENSMUST00000043767
AA Change: K252E

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037354
Gene: ENSMUSG00000038398
AA Change: K252E

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:Smg4_UPF3 63 224 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211724
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome 13. Two splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The gene product protects against mRNA transcript degradation. Homozygous constitutive KO is embryonic lethal. Homozygous conditional KO in testes leads to reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Other mutations in Upf3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Upf3a APN 8 13786221 missense probably damaging 0.98
IGL01678:Upf3a APN 8 13791930 missense probably benign 0.21
IGL02072:Upf3a APN 8 13798368 missense probably damaging 0.99
R0309:Upf3a UTSW 8 13795500 splice site probably null
R0571:Upf3a UTSW 8 13792184 missense probably damaging 0.98
R0826:Upf3a UTSW 8 13798338 missense possibly damaging 0.65
R1387:Upf3a UTSW 8 13792118 missense probably damaging 1.00
R1913:Upf3a UTSW 8 13792108 missense probably damaging 1.00
R2072:Upf3a UTSW 8 13785850 missense possibly damaging 0.63
R2520:Upf3a UTSW 8 13796443 intron probably null
R3845:Upf3a UTSW 8 13798238 missense probably benign 0.16
R4239:Upf3a UTSW 8 13796591 missense probably benign 0.28
R4424:Upf3a UTSW 8 13796573 missense probably benign 0.09
R5522:Upf3a UTSW 8 13795497 critical splice donor site probably null
R6321:Upf3a UTSW 8 13787466 missense possibly damaging 0.53
R6922:Upf3a UTSW 8 13791911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGAATGTCCCCAGGTGCGGTG -3'
(R):5'- ACCGACAACGGTCGATGAATTACAG -3'

Sequencing Primer
(F):5'- AGAAGGACCACCCCTCTTTTG -3'
(R):5'- TTACAGAGCTACGCTACTTCAG -3'
Posted On2013-06-11