Incidental Mutation 'R0564:Adamtsl5'
ID46077
Institutional Source Beutler Lab
Gene Symbol Adamtsl5
Ensembl Gene ENSMUSG00000043822
Gene NameADAMTS-like 5
SynonymsThsd6, 2010109H09Rik
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80339110-80348412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80344847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 127 (V127A)
Ref Sequence ENSEMBL: ENSMUSP00000100989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095446] [ENSMUST00000105352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095446
AA Change: V127A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093097
Gene: ENSMUSG00000043822
AA Change: V127A

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
TSP1 49 98 2.51e-10 SMART
Pfam:ADAM_spacer1 203 312 1.1e-27 PFAM
low complexity region 329 344 N/A INTRINSIC
Pfam:NTR 378 481 2.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105352
AA Change: V127A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100989
Gene: ENSMUSG00000043822
AA Change: V127A

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
TSP1 49 98 2.51e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138705
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Adamtsl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Adamtsl5 APN 10 80344916 missense probably damaging 1.00
IGL01788:Adamtsl5 APN 10 80344923 missense probably benign 0.02
IGL02352:Adamtsl5 APN 10 80343728 critical splice acceptor site probably null
IGL02359:Adamtsl5 APN 10 80343728 critical splice acceptor site probably null
IGL02380:Adamtsl5 APN 10 80341778 missense probably benign
IGL02898:Adamtsl5 APN 10 80342231 unclassified probably benign
R1399:Adamtsl5 UTSW 10 80341208 missense probably damaging 1.00
R1652:Adamtsl5 UTSW 10 80342177 missense probably benign
R3433:Adamtsl5 UTSW 10 80342891 missense probably benign
R4157:Adamtsl5 UTSW 10 80345322 missense probably null 1.00
R4395:Adamtsl5 UTSW 10 80344902 missense probably damaging 1.00
R5238:Adamtsl5 UTSW 10 80345358 missense probably damaging 1.00
R5309:Adamtsl5 UTSW 10 80345148 intron probably benign
R5608:Adamtsl5 UTSW 10 80342947 missense probably benign 0.06
R6468:Adamtsl5 UTSW 10 80341913 missense possibly damaging 0.65
R6885:Adamtsl5 UTSW 10 80343631 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCCGTGCAACAACATTTCCTG -3'
(R):5'- ACTTGGTTCTGCCCACCTCAAATAC -3'

Sequencing Primer
(F):5'- AACTGTTGGCCTCTGGATAAGAC -3'
(R):5'- AAATACCCCTTGTTGGTTTGC -3'
Posted On2013-06-11