Incidental Mutation 'R0564:Alox12'
ID46079
Institutional Source Beutler Lab
Gene Symbol Alox12
Ensembl Gene ENSMUSG00000000320
Gene Namearachidonate 12-lipoxygenase
SynonymsP-12LO, 9930022G08Rik, Alox12p
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70241457-70255353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70252836 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 202 (D202V)
Ref Sequence ENSEMBL: ENSMUSP00000104214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000329] [ENSMUST00000108574]
Predicted Effect probably damaging
Transcript: ENSMUST00000000329
AA Change: D202V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000329
Gene: ENSMUSG00000000320
AA Change: D202V

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 172 650 5.1e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108574
AA Change: D202V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104214
Gene: ENSMUSG00000000320
AA Change: D202V

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 121 211 8.1e-9 PFAM
Pfam:Lipoxygenase 210 390 3e-61 PFAM
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased basal transepidermal water loss and hypersensitivity to adenosine 5'-diphosphate-induced platelet aggregation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Alox12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Alox12 APN 11 70254549 missense probably benign 0.12
IGL01629:Alox12 APN 11 70242834 missense probably damaging 1.00
IGL02657:Alox12 APN 11 70247278 missense probably benign
IGL02966:Alox12 APN 11 70250085 missense probably damaging 1.00
R0243:Alox12 UTSW 11 70242716 missense possibly damaging 0.82
R0357:Alox12 UTSW 11 70242536 missense probably damaging 1.00
R0394:Alox12 UTSW 11 70245935 missense probably damaging 1.00
R0422:Alox12 UTSW 11 70254558 missense probably damaging 1.00
R0751:Alox12 UTSW 11 70246950 missense probably benign 0.00
R1539:Alox12 UTSW 11 70253243 splice site probably null
R1562:Alox12 UTSW 11 70250165 missense probably damaging 0.97
R2165:Alox12 UTSW 11 70242572 unclassified probably null
R2295:Alox12 UTSW 11 70242465 missense probably benign 0.45
R4073:Alox12 UTSW 11 70247310 missense probably damaging 1.00
R4558:Alox12 UTSW 11 70253063 missense probably benign 0.03
R5081:Alox12 UTSW 11 70255314 utr 5 prime probably null
R5198:Alox12 UTSW 11 70254417 missense probably damaging 1.00
R5507:Alox12 UTSW 11 70254412 missense possibly damaging 0.87
R5793:Alox12 UTSW 11 70243053 missense probably benign 0.00
R5832:Alox12 UTSW 11 70253280 missense probably damaging 0.98
R5975:Alox12 UTSW 11 70242783 missense possibly damaging 0.89
R5984:Alox12 UTSW 11 70247055 missense possibly damaging 0.83
R5988:Alox12 UTSW 11 70251587 missense probably benign 0.05
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6248:Alox12 UTSW 11 70253110 missense probably damaging 1.00
R6505:Alox12 UTSW 11 70250204 missense probably damaging 1.00
X0025:Alox12 UTSW 11 70255224 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTAGACTATCCTACGCTCAGCCC -3'
(R):5'- GACTTTGAATGGACGTTGAAGGCGG -3'

Sequencing Primer
(F):5'- GCTCAGCCCAGGTTTATTTTTG -3'
(R):5'- CGTTGAAGGCGGGGTAAG -3'
Posted On2013-06-11