Incidental Mutation 'R5908:Foxo3'
ID460795
Institutional Source Beutler Lab
Gene Symbol Foxo3
Ensembl Gene ENSMUSG00000048756
Gene Nameforkhead box O3
SynonymsFKHRL1, 2010203A17Rik, 1110048B16Rik, Foxo3a, Fkhr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5908 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location42181841-42276755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42196587 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 645 (I645V)
Ref Sequence ENSEMBL: ENSMUSP00000135380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056974] [ENSMUST00000105502] [ENSMUST00000175881] [ENSMUST00000177542]
Predicted Effect probably benign
Transcript: ENSMUST00000056974
AA Change: I645V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050683
Gene: ENSMUSG00000048756
AA Change: I645V

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Pfam:FOXO_KIX_bdg 431 510 5.5e-36 PFAM
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Pfam:FOXO-TAD 603 644 1.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105502
AA Change: I645V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101141
Gene: ENSMUSG00000048756
AA Change: I645V

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175881
AA Change: I645V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135380
Gene: ENSMUSG00000048756
AA Change: I645V

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177542
SMART Domains Protein: ENSMUSP00000135355
Gene: ENSMUSG00000048756

DomainStartEndE-ValueType
SCOP:d1e17a_ 1 21 3e-4 SMART
Blast:FH 1 28 4e-10 BLAST
PDB:3COA|F 1 43 1e-18 PDB
low complexity region 47 57 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. This gene likely functions as a trigger for apoptosis through expression of genes necessary for cell death. Translocation of this gene with the MLL gene is associated with secondary acute leukemia. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of the locus results in an ovarian defect involving follicular growth activation and leads progressively to female sterility. For some alleles defects in immune system function and hematopoiesis have also been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,228 I131N probably benign Het
Abcc10 A T 17: 46,313,804 L198H probably damaging Het
Anks1 C T 17: 27,996,019 T480I probably damaging Het
Arhgef18 G A 8: 3,453,165 R857Q probably damaging Het
B230208B08Rik A G 4: 78,214,060 noncoding transcript Het
B9d2 T A 7: 25,683,299 W33R probably damaging Het
Bcl2a1c A G 9: 114,330,504 T117A probably benign Het
Btbd8 T G 5: 107,507,594 D574E probably damaging Het
C77080 A G 4: 129,222,148 S908P probably damaging Het
Cabin1 A G 10: 75,721,532 S1091P probably damaging Het
Clip3 C A 7: 30,296,873 D64E probably damaging Het
Col6a5 C G 9: 105,862,801 D2540H possibly damaging Het
Commd5 A T 15: 76,900,936 M178L probably benign Het
Crtc3 T A 7: 80,595,794 H361L possibly damaging Het
Dip2b T A 15: 100,151,184 L153Q possibly damaging Het
Eif2s1 T A 12: 78,880,043 V189D probably damaging Het
Etl4 C T 2: 20,743,907 A483V probably damaging Het
Gm4841 A G 18: 60,270,434 S196P possibly damaging Het
Hip1 A G 5: 135,424,863 probably null Het
Il1f5 G T 2: 24,277,490 probably benign Het
Ints2 A G 11: 86,215,545 probably null Het
Khnyn A G 14: 55,887,066 D259G probably benign Het
Lyst T A 13: 13,696,761 Y2694* probably null Het
Map4k2 T C 19: 6,351,316 probably benign Het
March10 C T 11: 105,390,239 V407I probably benign Het
Mast4 C A 13: 102,738,256 V1367F probably damaging Het
Mrgprb3 A T 7: 48,643,618 S62T probably damaging Het
Mthfd1l T C 10: 4,089,392 F801S probably damaging Het
Notch2 T C 3: 98,123,923 probably benign Het
Nr2e1 T C 10: 42,572,769 S158G probably benign Het
Nup214 A G 2: 31,991,341 I404V probably benign Het
Olfr702 T C 7: 106,824,197 T110A probably benign Het
Pik3c2g G A 6: 139,768,710 R196H probably damaging Het
Pik3r3 A T 4: 116,272,758 D213V probably benign Het
Pip5k1b A T 19: 24,397,137 S27T possibly damaging Het
Pkp1 G A 1: 135,918,883 Q44* probably null Het
Pnmal2 C T 7: 16,947,043 R651C unknown Het
Pnpt1 T A 11: 29,130,887 S44T probably benign Het
Polb A T 8: 22,642,303 probably null Het
Pom121l2 A G 13: 21,981,814 N85S probably damaging Het
Prim1 A G 10: 128,018,024 K104E probably damaging Het
Prl8a1 T A 13: 27,574,057 Y223F probably benign Het
Rbak T G 5: 143,173,636 H554P probably damaging Het
Serpina3c T C 12: 104,151,711 R123G probably benign Het
Sh3bp4 T G 1: 89,145,883 S818A probably damaging Het
Sh3rf3 C G 10: 59,049,448 H384Q probably benign Het
Slc9a8 C T 2: 167,451,170 probably benign Het
Sptbn4 T C 7: 27,404,253 E1181G probably benign Het
Taf2 G A 15: 55,072,006 probably benign Het
Tbc1d9 A T 8: 83,249,545 M578L probably benign Het
Tinagl1 G T 4: 130,172,970 Y111* probably null Het
Tor2a T C 2: 32,761,685 L304P probably damaging Het
Trp53bp1 A G 2: 121,236,823 V474A probably benign Het
Trrap C A 5: 144,786,708 A325E probably damaging Het
Ube4a A G 9: 44,948,024 probably null Het
Use1 G C 8: 71,369,613 K239N probably damaging Het
Vps9d1 G T 8: 123,246,824 Q407K probably benign Het
Zfp36l1 A T 12: 80,109,675 S311T possibly damaging Het
Zfp729b T C 13: 67,591,255 K964E probably benign Het
Zfp974 T A 7: 27,910,957 M448L probably benign Het
Zfyve28 A T 5: 34,216,870 V600E possibly damaging Het
Other mutations in Foxo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0486:Foxo3 UTSW 10 42197481 missense probably damaging 1.00
R1558:Foxo3 UTSW 10 42197072 missense probably damaging 0.99
R1819:Foxo3 UTSW 10 42197611 missense probably benign 0.12
R1970:Foxo3 UTSW 10 42197262 missense probably benign 0.24
R1971:Foxo3 UTSW 10 42197262 missense probably benign 0.24
R2447:Foxo3 UTSW 10 42197820 missense probably benign
R3016:Foxo3 UTSW 10 42197356 missense probably benign 0.00
R4719:Foxo3 UTSW 10 42197778 missense probably damaging 1.00
R4926:Foxo3 UTSW 10 42197024 missense probably damaging 0.98
R6053:Foxo3 UTSW 10 42197214 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ATGCGCTGTCAGGATAGGAGTC -3'
(R):5'- GTCTATGCAAACCCTCTCGGAC -3'

Sequencing Primer
(F):5'- TGTCAGGATAGGAGTCACCCC -3'
(R):5'- TCGGACTCTCTCTCAGGC -3'
Posted On2017-02-28