Incidental Mutation 'R5908:Mast4'
ID460812
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R5908 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102738256 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1367 (V1367F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099202
AA Change: V1358F

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: V1358F

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: V1535F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: V1535F

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000171791
AA Change: V1343F

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: V1343F

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect probably damaging
Transcript: ENSMUST00000194446
AA Change: V1367F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,228 I131N probably benign Het
Abcc10 A T 17: 46,313,804 L198H probably damaging Het
Anks1 C T 17: 27,996,019 T480I probably damaging Het
Arhgef18 G A 8: 3,453,165 R857Q probably damaging Het
B230208B08Rik A G 4: 78,214,060 noncoding transcript Het
B9d2 T A 7: 25,683,299 W33R probably damaging Het
Bcl2a1c A G 9: 114,330,504 T117A probably benign Het
Btbd8 T G 5: 107,507,594 D574E probably damaging Het
C77080 A G 4: 129,222,148 S908P probably damaging Het
Cabin1 A G 10: 75,721,532 S1091P probably damaging Het
Clip3 C A 7: 30,296,873 D64E probably damaging Het
Col6a5 C G 9: 105,862,801 D2540H possibly damaging Het
Commd5 A T 15: 76,900,936 M178L probably benign Het
Crtc3 T A 7: 80,595,794 H361L possibly damaging Het
Dip2b T A 15: 100,151,184 L153Q possibly damaging Het
Eif2s1 T A 12: 78,880,043 V189D probably damaging Het
Etl4 C T 2: 20,743,907 A483V probably damaging Het
Foxo3 T C 10: 42,196,587 I645V probably benign Het
Gm4841 A G 18: 60,270,434 S196P possibly damaging Het
Hip1 A G 5: 135,424,863 probably null Het
Il1f5 G T 2: 24,277,490 probably benign Het
Ints2 A G 11: 86,215,545 probably null Het
Khnyn A G 14: 55,887,066 D259G probably benign Het
Lyst T A 13: 13,696,761 Y2694* probably null Het
Map4k2 T C 19: 6,351,316 probably benign Het
March10 C T 11: 105,390,239 V407I probably benign Het
Mrgprb3 A T 7: 48,643,618 S62T probably damaging Het
Mthfd1l T C 10: 4,089,392 F801S probably damaging Het
Notch2 T C 3: 98,123,923 probably benign Het
Nr2e1 T C 10: 42,572,769 S158G probably benign Het
Nup214 A G 2: 31,991,341 I404V probably benign Het
Olfr702 T C 7: 106,824,197 T110A probably benign Het
Pik3c2g G A 6: 139,768,710 R196H probably damaging Het
Pik3r3 A T 4: 116,272,758 D213V probably benign Het
Pip5k1b A T 19: 24,397,137 S27T possibly damaging Het
Pkp1 G A 1: 135,918,883 Q44* probably null Het
Pnmal2 C T 7: 16,947,043 R651C unknown Het
Pnpt1 T A 11: 29,130,887 S44T probably benign Het
Polb A T 8: 22,642,303 probably null Het
Pom121l2 A G 13: 21,981,814 N85S probably damaging Het
Prim1 A G 10: 128,018,024 K104E probably damaging Het
Prl8a1 T A 13: 27,574,057 Y223F probably benign Het
Rbak T G 5: 143,173,636 H554P probably damaging Het
Serpina3c T C 12: 104,151,711 R123G probably benign Het
Sh3bp4 T G 1: 89,145,883 S818A probably damaging Het
Sh3rf3 C G 10: 59,049,448 H384Q probably benign Het
Slc9a8 C T 2: 167,451,170 probably benign Het
Sptbn4 T C 7: 27,404,253 E1181G probably benign Het
Taf2 G A 15: 55,072,006 probably benign Het
Tbc1d9 A T 8: 83,249,545 M578L probably benign Het
Tinagl1 G T 4: 130,172,970 Y111* probably null Het
Tor2a T C 2: 32,761,685 L304P probably damaging Het
Trp53bp1 A G 2: 121,236,823 V474A probably benign Het
Trrap C A 5: 144,786,708 A325E probably damaging Het
Ube4a A G 9: 44,948,024 probably null Het
Use1 G C 8: 71,369,613 K239N probably damaging Het
Vps9d1 G T 8: 123,246,824 Q407K probably benign Het
Zfp36l1 A T 12: 80,109,675 S311T possibly damaging Het
Zfp729b T C 13: 67,591,255 K964E probably benign Het
Zfp974 T A 7: 27,910,957 M448L probably benign Het
Zfyve28 A T 5: 34,216,870 V600E possibly damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTGTCCTTCAGCAGGC -3'
(R):5'- GCAAGCATAGCCTAGAGGTGAC -3'

Sequencing Primer
(F):5'- TTCAGCAGGCTGCCCACAG -3'
(R):5'- CATAGCCTAGAGGTGACACAAG -3'
Posted On2017-02-28