Incidental Mutation 'R5908:Dip2b'
ID460816
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R5908 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100151184 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 153 (L153Q)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
Predicted Effect probably benign
Transcript: ENSMUST00000023768
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100203
AA Change: L153Q

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: L153Q

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,228 I131N probably benign Het
Abcc10 A T 17: 46,313,804 L198H probably damaging Het
Anks1 C T 17: 27,996,019 T480I probably damaging Het
Arhgef18 G A 8: 3,453,165 R857Q probably damaging Het
B230208B08Rik A G 4: 78,214,060 noncoding transcript Het
B9d2 T A 7: 25,683,299 W33R probably damaging Het
Bcl2a1c A G 9: 114,330,504 T117A probably benign Het
Btbd8 T G 5: 107,507,594 D574E probably damaging Het
C77080 A G 4: 129,222,148 S908P probably damaging Het
Cabin1 A G 10: 75,721,532 S1091P probably damaging Het
Clip3 C A 7: 30,296,873 D64E probably damaging Het
Col6a5 C G 9: 105,862,801 D2540H possibly damaging Het
Commd5 A T 15: 76,900,936 M178L probably benign Het
Crtc3 T A 7: 80,595,794 H361L possibly damaging Het
Eif2s1 T A 12: 78,880,043 V189D probably damaging Het
Etl4 C T 2: 20,743,907 A483V probably damaging Het
Foxo3 T C 10: 42,196,587 I645V probably benign Het
Gm4841 A G 18: 60,270,434 S196P possibly damaging Het
Hip1 A G 5: 135,424,863 probably null Het
Il1f5 G T 2: 24,277,490 probably benign Het
Ints2 A G 11: 86,215,545 probably null Het
Khnyn A G 14: 55,887,066 D259G probably benign Het
Lyst T A 13: 13,696,761 Y2694* probably null Het
Map4k2 T C 19: 6,351,316 probably benign Het
March10 C T 11: 105,390,239 V407I probably benign Het
Mast4 C A 13: 102,738,256 V1367F probably damaging Het
Mrgprb3 A T 7: 48,643,618 S62T probably damaging Het
Mthfd1l T C 10: 4,089,392 F801S probably damaging Het
Notch2 T C 3: 98,123,923 probably benign Het
Nr2e1 T C 10: 42,572,769 S158G probably benign Het
Nup214 A G 2: 31,991,341 I404V probably benign Het
Olfr702 T C 7: 106,824,197 T110A probably benign Het
Pik3c2g G A 6: 139,768,710 R196H probably damaging Het
Pik3r3 A T 4: 116,272,758 D213V probably benign Het
Pip5k1b A T 19: 24,397,137 S27T possibly damaging Het
Pkp1 G A 1: 135,918,883 Q44* probably null Het
Pnmal2 C T 7: 16,947,043 R651C unknown Het
Pnpt1 T A 11: 29,130,887 S44T probably benign Het
Polb A T 8: 22,642,303 probably null Het
Pom121l2 A G 13: 21,981,814 N85S probably damaging Het
Prim1 A G 10: 128,018,024 K104E probably damaging Het
Prl8a1 T A 13: 27,574,057 Y223F probably benign Het
Rbak T G 5: 143,173,636 H554P probably damaging Het
Serpina3c T C 12: 104,151,711 R123G probably benign Het
Sh3bp4 T G 1: 89,145,883 S818A probably damaging Het
Sh3rf3 C G 10: 59,049,448 H384Q probably benign Het
Slc9a8 C T 2: 167,451,170 probably benign Het
Sptbn4 T C 7: 27,404,253 E1181G probably benign Het
Taf2 G A 15: 55,072,006 probably benign Het
Tbc1d9 A T 8: 83,249,545 M578L probably benign Het
Tinagl1 G T 4: 130,172,970 Y111* probably null Het
Tor2a T C 2: 32,761,685 L304P probably damaging Het
Trp53bp1 A G 2: 121,236,823 V474A probably benign Het
Trrap C A 5: 144,786,708 A325E probably damaging Het
Ube4a A G 9: 44,948,024 probably null Het
Use1 G C 8: 71,369,613 K239N probably damaging Het
Vps9d1 G T 8: 123,246,824 Q407K probably benign Het
Zfp36l1 A T 12: 80,109,675 S311T possibly damaging Het
Zfp729b T C 13: 67,591,255 K964E probably benign Het
Zfp974 T A 7: 27,910,957 M448L probably benign Het
Zfyve28 A T 5: 34,216,870 V600E possibly damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 unclassified probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 unclassified probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 unclassified probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATACTTGGGAGATGTCACCAC -3'
(R):5'- CCAAGTGGAACATTGGGTGG -3'

Sequencing Primer
(F):5'- CTTGGGAGATGTCACCACTAATC -3'
(R):5'- CCTACCTATTCGAGTATTGGCAAAC -3'
Posted On2017-02-28