Incidental Mutation 'R0564:Hist1h1t'
ID46086
Institutional Source Beutler Lab
Gene Symbol Hist1h1t
Ensembl Gene ENSMUSG00000036211
Gene Namehistone cluster 1, H1t
SynonymsH1ft
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23695814-23696725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23696324 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 153 (K153N)
Ref Sequence ENSEMBL: ENSMUSP00000037304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018246] [ENSMUST00000041052] [ENSMUST00000102967]
Predicted Effect probably benign
Transcript: ENSMUST00000018246
SMART Domains Protein: ENSMUSP00000018246
Gene: ENSMUSG00000018102

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000041052
AA Change: K153N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037304
Gene: ENSMUSG00000036211
AA Change: K153N

DomainStartEndE-ValueType
H15 37 102 5.15e-21 SMART
low complexity region 111 135 N/A INTRINSIC
low complexity region 142 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102967
SMART Domains Protein: ENSMUSP00000100032
Gene: ENSMUSG00000060678

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice develop normally and exhibit normal testicular morphology, spermatogenesis and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Hist1h1t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Hist1h1t APN 13 23696049 missense probably damaging 0.98
FR4304:Hist1h1t UTSW 13 23695920 unclassified probably benign
FR4342:Hist1h1t UTSW 13 23695913 unclassified probably benign
FR4548:Hist1h1t UTSW 13 23695920 unclassified probably benign
R0167:Hist1h1t UTSW 13 23695903 missense probably benign 0.02
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0726:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0827:Hist1h1t UTSW 13 23696221 missense probably benign 0.01
R0972:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1128:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1129:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1130:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R5652:Hist1h1t UTSW 13 23696236 missense probably benign 0.01
R5827:Hist1h1t UTSW 13 23696202 missense possibly damaging 0.91
R6538:Hist1h1t UTSW 13 23695921 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CGTGGAGAAGAACAACAGCCGTATC -3'
(R):5'- GTGGAAGCTCCTACTGGCGTTATC -3'

Sequencing Primer
(F):5'- GTATCAAGCTGGCCCTCAAGAG -3'
(R):5'- CTAGGGTTTCAACGACAGGTC -3'
Posted On2013-06-11