Incidental Mutation 'R5909:Bdp1'
ID460875
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission 044106-MU
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5909 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100092286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 278 (V278A)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably benign
Transcript: ENSMUST00000038104
AA Change: V278A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: V278A

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109379
AA Change: V278A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: V278A

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167203
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T C 9: 30,961,928 S810P probably benign Het
Adcy7 A T 8: 88,325,496 I931F probably damaging Het
Alcam G T 16: 52,290,993 Q248K probably benign Het
Astn1 A C 1: 158,601,937 R750S probably damaging Het
Atp1a2 A T 1: 172,287,230 N329K probably damaging Het
Bcl6 A G 16: 23,972,806 V266A probably benign Het
Ccdc162 T C 10: 41,561,115 E493G probably damaging Het
Cpvl T C 6: 53,932,428 Y241C probably damaging Het
Ddx55 T C 5: 124,566,850 M390T probably benign Het
Ero1lb A G 13: 12,579,258 E102G probably benign Het
Etnk1 A G 6: 143,197,438 D273G probably benign Het
Exoc3 A G 13: 74,199,524 V109A probably damaging Het
F830016B08Rik T A 18: 60,300,019 I58N probably damaging Het
Fancd2 T A 6: 113,561,711 V589E probably benign Het
Fbll1 G A 11: 35,798,332 R35C unknown Het
Fnbp1 A G 2: 31,048,199 probably null Het
Glce G T 9: 62,060,144 A575D probably damaging Het
Gm14548 G A 7: 3,897,622 T43I probably damaging Het
Ift20 T A 11: 78,540,041 M70K possibly damaging Het
Impg2 T C 16: 56,258,136 V487A probably damaging Het
Isx A G 8: 74,892,798 D206G probably benign Het
Jak3 A G 8: 71,684,231 I684V possibly damaging Het
Kdm5d G A Y: 941,306 S1169N probably benign Het
Krt35 A T 11: 100,095,813 L125Q probably damaging Het
Lama4 G A 10: 39,072,859 A873T probably benign Het
Lrch4 T C 5: 137,633,865 S74P possibly damaging Het
Maneal A T 4: 124,857,173 Y263* probably null Het
Mcat C T 15: 83,547,915 A251T probably benign Het
Mup3 T G 4: 62,086,007 T90P probably benign Het
Mybpc2 G A 7: 44,507,091 A812V probably damaging Het
Naa15 T C 3: 51,460,064 F503L probably damaging Het
Nudt8 T C 19: 4,000,727 L25S possibly damaging Het
Oas1e A T 5: 120,788,907 V245D probably damaging Het
Ofcc1 A G 13: 40,263,578 M109T possibly damaging Het
Olfr1179 A T 2: 88,402,191 F248I probably damaging Het
Olfr48 A G 2: 89,844,391 V194A possibly damaging Het
Phkb G T 8: 86,021,447 probably null Het
Pidd1 A C 7: 141,441,270 L365R probably damaging Het
Pkd1l2 G A 8: 117,024,056 R1739C probably benign Het
Pkdrej A T 15: 85,818,296 D1146E possibly damaging Het
Pkhd1l1 G T 15: 44,526,763 W1425L probably damaging Het
Plxna4 A G 6: 32,517,246 L145P probably damaging Het
Plxnd1 G T 6: 115,968,688 D941E probably benign Het
Prdm13 G T 4: 21,683,894 Q126K unknown Het
Rbm25 T A 12: 83,681,588 V837E probably damaging Het
Rcc2 T A 4: 140,717,068 Y357N probably damaging Het
Siglec1 A T 2: 131,077,964 N882K probably damaging Het
Sox13 A G 1: 133,383,889 I535T probably benign Het
Srrm2 T C 17: 23,821,317 S2408P probably benign Het
Stat3 G A 11: 100,903,730 T251I probably benign Het
Sulf1 A T 1: 12,858,815 D102V possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem145 G T 7: 25,308,193 L208F possibly damaging Het
Trim17 A T 11: 58,968,680 E240V probably damaging Het
Trim43b A T 9: 89,085,398 I395K possibly damaging Het
Trmt61a C A 12: 111,680,858 H130N probably damaging Het
Unc5b A C 10: 60,772,359 L654R probably damaging Het
Vmn1r66 A T 7: 10,274,342 S255T probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb10 T C 3: 9,280,049 F677S probably benign Het
Zfp493 T A 13: 67,786,598 C223* probably null Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7562:Bdp1 UTSW 13 100025541 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAACCAACGTGGCAGGTTCC -3'
(R):5'- ACAGGTTGGCATTTATTTCTGTACC -3'

Sequencing Primer
(F):5'- ACGTGGCAGGTTCCATTTTATTTAC -3'
(R):5'- CTGTACTAAGTGCTGTGTAAA -3'
Posted On2017-02-28