Incidental Mutation 'R0564:Micu2'
ID46088
Institutional Source Beutler Lab
Gene Symbol Micu2
Ensembl Gene ENSMUSG00000021973
Gene Namemitochondrial calcium uptake 2
Synonyms4833427E09Rik, 1110008L20Rik, Efha1
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R0564 (G1)
Quality Score207
Status Validated
Chromosome14
Chromosomal Location57916261-57999262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57919374 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 335 (F335L)
Ref Sequence ENSEMBL: ENSMUSP00000022543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022543
AA Change: F335L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022543
Gene: ENSMUSG00000021973
AA Change: F335L

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 35 50 N/A INTRINSIC
EFh 173 201 1.15e0 SMART
EFh 363 391 1.12e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225961
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit an enlarged heart left atrium along with delayed calcium reuptake and decreased relaxation rates by cardiomyocytes, and develop abdominal aortic aneurysms with spontaneous rupture following angiotensin II treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Micu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Micu2 APN 14 57943625 missense probably damaging 1.00
IGL02416:Micu2 APN 14 57923965 missense probably damaging 0.99
IGL02675:Micu2 APN 14 57945377 splice site probably benign
IGL03343:Micu2 APN 14 57917311 missense probably benign 0.01
ANU22:Micu2 UTSW 14 57943625 missense probably damaging 1.00
R0238:Micu2 UTSW 14 57917378 splice site probably benign
R0239:Micu2 UTSW 14 57917378 splice site probably benign
R0488:Micu2 UTSW 14 57932242 missense probably benign 0.00
R1116:Micu2 UTSW 14 57954200 missense probably benign 0.00
R1471:Micu2 UTSW 14 57945397 missense probably damaging 0.99
R2011:Micu2 UTSW 14 57954133 splice site probably null
R4226:Micu2 UTSW 14 57932285 missense possibly damaging 0.92
R5595:Micu2 UTSW 14 57971744 missense probably damaging 1.00
R6583:Micu2 UTSW 14 57943670 missense probably damaging 0.99
R6800:Micu2 UTSW 14 57919439 missense possibly damaging 0.89
R7125:Micu2 UTSW 14 57971781 nonsense probably null
R7205:Micu2 UTSW 14 57954149 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GGCTCCCAGGAACATCGTCAAATC -3'
(R):5'- CATCAGCCTTTCAGGAATACAGCCC -3'

Sequencing Primer
(F):5'- GGAACATCGTCAAATCCCACTC -3'
(R):5'- CTCCTTACAAGAGGGCTAGAAGATTC -3'
Posted On2013-06-11