Incidental Mutation 'R5910:Cfap54'
ID460937
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5910 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93065181 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 170 (N170K)
Ref Sequence ENSEMBL: ENSMUSP00000127905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020200] [ENSMUST00000168110] [ENSMUST00000168617] [ENSMUST00000212902]
Predicted Effect probably damaging
Transcript: ENSMUST00000020200
AA Change: N218K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014
AA Change: N218K

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 103 643 3e-298 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168080
Predicted Effect probably damaging
Transcript: ENSMUST00000168110
AA Change: N218K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: N218K

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168617
AA Change: N170K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014
AA Change: N170K

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 103 148 4.3e-22 PFAM
Pfam:DUF4486 145 595 1.6e-244 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171781
Predicted Effect probably damaging
Transcript: ENSMUST00000212902
AA Change: N218K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 95% (93/98)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,117 N976D probably damaging Het
Adamts1 G A 16: 85,802,149 R188W probably benign Het
Adcy4 A T 14: 55,779,013 V327D probably damaging Het
Alg8 T C 7: 97,390,286 I408T possibly damaging Het
Ankib1 T C 5: 3,693,217 S933G probably benign Het
Ap2a2 A G 7: 141,598,778 D106G probably damaging Het
Arhgap22 A T 14: 33,366,615 H351L probably damaging Het
Arhgef2 A G 3: 88,635,020 Y310C probably damaging Het
Atm A T 9: 53,448,080 S2804R probably damaging Het
Baz2b A G 2: 59,977,426 L163P possibly damaging Het
Bcl2l12 C T 7: 44,996,543 probably null Het
Cdh23 A G 10: 60,377,821 V1495A possibly damaging Het
Cep78 A G 19: 15,969,128 S447P possibly damaging Het
Cfap43 G A 19: 47,780,271 T778I possibly damaging Het
Cmya5 A T 13: 93,092,643 L1979Q probably damaging Het
Col15a1 A T 4: 47,289,514 E846D probably damaging Het
Col5a1 A G 2: 28,036,888 K308E possibly damaging Het
Dcst1 T A 3: 89,350,424 T680S possibly damaging Het
Dsp T C 13: 38,192,469 L1410P possibly damaging Het
Edem3 T A 1: 151,770,827 probably null Het
Eif4e2 T A 1: 87,220,974 Y64N probably damaging Het
Fcgbp C T 7: 28,085,503 probably benign Het
Gm11639 A T 11: 104,690,934 E34V probably benign Het
Gm7275 A T 16: 48,073,463 noncoding transcript Het
Grin3b G T 10: 79,973,021 V202L probably benign Het
Gsdmc4 G A 15: 63,895,252 S223F possibly damaging Het
Hbp1 T C 12: 31,937,652 H183R probably benign Het
Hectd3 A G 4: 117,002,134 M652V probably benign Het
Hist1h2bm A G 13: 21,722,300 N68S probably benign Het
Hmgxb4 T C 8: 74,999,565 F13L probably benign Het
Hnrnpab T C 11: 51,601,454 K271R probably benign Het
Ilvbl A T 10: 78,577,113 K156N probably benign Het
Iqce A T 5: 140,702,218 probably benign Het
Itpr2 C A 6: 146,329,571 V1194L probably benign Het
Kif18b A G 11: 102,913,544 F384L probably benign Het
Klf14 A G 6: 30,957,839 Y287H probably benign Het
Klhl6 A G 16: 19,957,094 M238T probably benign Het
Lbp G A 2: 158,324,557 V344I probably benign Het
Lrp12 T C 15: 39,876,043 probably null Het
Mapk7 T A 11: 61,493,621 M1L probably benign Het
Muc5b A G 7: 141,861,311 T2665A possibly damaging Het
Ncln A T 10: 81,496,078 probably null Het
Nfxl1 T C 5: 72,540,365 R347G probably benign Het
Npnt C A 3: 132,906,418 C231F probably damaging Het
Nrap T A 19: 56,342,311 H1070L probably benign Het
Nrxn1 G T 17: 90,704,318 Y294* probably null Het
Olfr1261 A G 2: 89,993,438 D15G probably benign Het
Olfr1412 T C 1: 92,588,707 Y126H probably damaging Het
Otog A G 7: 46,298,598 H2341R possibly damaging Het
Paqr3 T C 5: 97,096,028 probably null Het
Pcdhb11 T C 18: 37,423,743 F709L probably benign Het
Phf12 G A 11: 78,027,398 R812Q probably damaging Het
Polr2a A T 11: 69,746,870 L216Q probably damaging Het
Polrmt A G 10: 79,743,497 L140P probably benign Het
Pou2f3 C T 9: 43,134,474 probably null Het
Prkcd A T 14: 30,595,981 N548K probably benign Het
Pygb A G 2: 150,815,700 D361G probably benign Het
Rpl9 A T 5: 65,388,701 probably benign Het
Rubcnl A T 14: 75,035,472 T211S probably benign Het
Rusc1 C T 3: 89,091,720 G252S probably benign Het
Scnn1g A G 7: 121,738,095 T60A probably damaging Het
Sipa1l2 T G 8: 125,491,684 T305P probably benign Het
Slc18b1 T A 10: 23,824,667 probably benign Het
Sp100 G A 1: 85,681,140 probably null Het
Tekt5 A T 16: 10,387,153 probably null Het
Tlnrd1 T A 7: 83,884,485 probably benign Het
Tpcn1 A G 5: 120,547,397 probably benign Het
Tpcn2 T C 7: 145,260,982 I461V probably benign Het
Traf3ip1 A G 1: 91,527,745 K643E probably damaging Het
Trim33 T C 3: 103,344,576 C914R probably damaging Het
Trip11 G A 12: 101,883,479 T1442I probably damaging Het
Ttll6 A G 11: 96,135,589 M107V possibly damaging Het
Uap1l1 A G 2: 25,363,433 probably benign Het
Ube3b T A 5: 114,415,309 I914N possibly damaging Het
Usp24 A G 4: 106,380,468 T1107A probably damaging Het
Usp40 A T 1: 87,968,400 C811* probably null Het
Vps11 T C 9: 44,359,135 probably null Het
Wdr91 A T 6: 34,891,487 I433N possibly damaging Het
Zfp770 G C 2: 114,196,232 S452* probably null Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.28
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCGTGTTACCATCAAACTTGG -3'
(R):5'- GAAGCCTGTATTGTATTTCTTTGCC -3'

Sequencing Primer
(F):5'- CCATCAAACTTGGCATTTAAATAGCC -3'
(R):5'- GTTTCATGCTTTGAGTGGAAA -3'
Posted On2017-02-28