Incidental Mutation 'R5911:Ttc4'
ID460983
Institutional Source Beutler Lab
Gene Symbol Ttc4
Ensembl Gene ENSMUSG00000025413
Gene Nametetratricopeptide repeat domain 4
Synonyms2810002P21Rik, L62
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106662256-106678944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106668043 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 298 (D298G)
Ref Sequence ENSEMBL: ENSMUSP00000026480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026480] [ENSMUST00000106772] [ENSMUST00000135676]
Predicted Effect probably damaging
Transcript: ENSMUST00000026480
AA Change: D298G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026480
Gene: ENSMUSG00000025413
AA Change: D298G

DomainStartEndE-ValueType
TPR 79 112 1.26e1 SMART
TPR 117 150 7.27e0 SMART
TPR 151 184 3.07e1 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106772
SMART Domains Protein: ENSMUSP00000102384
Gene: ENSMUSG00000025413

DomainStartEndE-ValueType
TPR 79 112 1.26e1 SMART
TPR 117 150 7.27e0 SMART
TPR 151 184 3.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132650
Predicted Effect probably benign
Transcript: ENSMUST00000135676
SMART Domains Protein: ENSMUSP00000116620
Gene: ENSMUSG00000025413

DomainStartEndE-ValueType
Pfam:TPR_11 77 148 1.1e-14 PFAM
Pfam:TPR_1 79 109 8.2e-5 PFAM
Pfam:TPR_2 79 110 1.2e-3 PFAM
Blast:TPR 173 203 1e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142342
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains tetratricopeptide (TPR) repeats, which often mediate protein-protein interactions and chaperone activity. The encoded protein interacts with heat shock proteins 70 and 90. Alternative splicing results in multiple transcript variants. Naturally-occuring readthrough transcription occurs from upstream gene MROH (maestro heat-like repeat family member 7) to this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Ttc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Ttc4 APN 4 106671648 missense probably benign 0.00
IGL01109:Ttc4 APN 4 106663163 missense probably damaging 1.00
IGL01825:Ttc4 APN 4 106671619 splice site probably null
IGL02221:Ttc4 APN 4 106676596 critical splice donor site probably null
IGL03333:Ttc4 APN 4 106676631 missense probably benign 0.19
IGL03385:Ttc4 APN 4 106668200 missense probably benign 0.00
R0398:Ttc4 UTSW 4 106667573 unclassified probably null
R1300:Ttc4 UTSW 4 106667566 missense probably damaging 1.00
R4250:Ttc4 UTSW 4 106665683 missense probably damaging 0.96
R5047:Ttc4 UTSW 4 106668238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCACCCAGACAGTGATG -3'
(R):5'- TCTCTGAATCAGCCGGTGAG -3'

Sequencing Primer
(F):5'- ACCTGTCTTGCCAGCAGGTAG -3'
(R):5'- CCGGTGAGGATGAAGATTCAGC -3'
Posted On2017-02-28