Incidental Mutation 'R5911:Pelp1'
ID461009
Institutional Source Beutler Lab
Gene Symbol Pelp1
Ensembl Gene ENSMUSG00000018921
Gene Nameproline, glutamic acid and leucine rich protein 1
SynonymsMNAR, 4930563C04Rik
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70392883-70410031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70396914 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 394 (R394H)
Ref Sequence ENSEMBL: ENSMUSP00000019065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019065]
Predicted Effect probably damaging
Transcript: ENSMUST00000019065
AA Change: R394H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019065
Gene: ENSMUSG00000018921
AA Change: R394H

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:RIX1 63 232 7.5e-30 PFAM
low complexity region 264 278 N/A INTRINSIC
low complexity region 359 386 N/A INTRINSIC
Pfam:NUC202 424 490 8.6e-30 PFAM
Pfam:NUC202 570 644 6e-19 PFAM
low complexity region 748 758 N/A INTRINSIC
low complexity region 797 830 N/A INTRINSIC
low complexity region 834 863 N/A INTRINSIC
low complexity region 869 877 N/A INTRINSIC
SCOP:d1sig__ 892 958 9e-6 SMART
low complexity region 974 989 N/A INTRINSIC
low complexity region 993 1021 N/A INTRINSIC
low complexity region 1070 1090 N/A INTRINSIC
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which coactivates transcription of estrogen receptor responsive genes and corepresses genes activated by other hormone receptors or sequence-specific transcription factors. Expression of this gene is regulated by both members of the estrogen receptor family. This gene may be involved in the progression of several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Pelp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Pelp1 APN 11 70394812 missense possibly damaging 0.88
IGL00819:Pelp1 APN 11 70394618 missense unknown
IGL01017:Pelp1 APN 11 70396894 missense probably damaging 1.00
IGL01347:Pelp1 APN 11 70395679 missense probably damaging 1.00
IGL01460:Pelp1 APN 11 70393964 missense unknown
IGL02022:Pelp1 APN 11 70406327 splice site probably benign
IGL02188:Pelp1 APN 11 70409892 missense unknown
ANU74:Pelp1 UTSW 11 70395087 missense probably damaging 0.97
F5770:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
R0056:Pelp1 UTSW 11 70393832 missense unknown
R0201:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0637:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0879:Pelp1 UTSW 11 70395297 splice site probably benign
R1073:Pelp1 UTSW 11 70396590 missense probably damaging 1.00
R1858:Pelp1 UTSW 11 70394742 missense probably damaging 0.99
R1937:Pelp1 UTSW 11 70393715 intron probably null
R1958:Pelp1 UTSW 11 70398521 missense probably damaging 0.99
R3613:Pelp1 UTSW 11 70395435 missense probably benign 0.01
R3722:Pelp1 UTSW 11 70398200 missense possibly damaging 0.62
R4176:Pelp1 UTSW 11 70396867 missense probably damaging 1.00
R5137:Pelp1 UTSW 11 70395099 missense probably damaging 0.98
R5253:Pelp1 UTSW 11 70401661 missense probably damaging 1.00
R5616:Pelp1 UTSW 11 70394862 missense possibly damaging 0.73
R5938:Pelp1 UTSW 11 70394867 missense probably damaging 0.98
R6461:Pelp1 UTSW 11 70396306 missense probably damaging 1.00
V7580:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7581:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7582:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7583:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
Z1088:Pelp1 UTSW 11 70396890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAATGGTGCTGGAGAAG -3'
(R):5'- ACTTGCTTGGAGATGGTCCC -3'

Sequencing Primer
(F):5'- TATGAACGAGAGCTGACATGCC -3'
(R):5'- AGATGGTCCCCTCAGGTTG -3'
Posted On2017-02-28